Short-Term Consumption of Honey-Sweetened Açai (Euterpe oleracea) Beverage Modulates Cytokine Expression and Oxidative Stress in the Visceral White Adipose Tissue of Rats Differently from the Commercially Available Glucose-Sweetened Açai Beverage
Renata Silvério1*, Rodrigo X. das Neves1, Fernando de O. Rosa1, Michele J. ALves1, Rodolfo G. Camargo1, Anelisa F. A. Magalhães1, Érico C. Caperuto2, Marília Seelaender1
1Institute of Biomedical Sciences and Department of Surgery, Medical School, University of São Paulo, São Paulo, Brazil
2Human Movement Laboratory, São Judas Tadeu University, São Paulo, Brazil
*Corresponding author: Renata Silvério, Cancer Metabolism Research Group, Institute of Biomedical Science, University of São Paulo, São Paulo, Brazil. Tel: +551130917225; Email: resfloripa@yahoo.com.br
Received Date: 16 November, 2017; Accepted Date: 07 December, 2017; Published Date: 15 December, 2017
Citation: Silvério R, das Neves RX, Rosa FO, Alves MJ, Camargo RG (2017) Short-Term Consumption of a Commercial HoneySweetened açai (Euterpe oleracea) Beverage Modulates Cytokine Expression and Oxidative Stress in the Visceral White Adipose Tissue of Rats Differently from the Glucose- Sweetened açai Beverage. Food Nutr J 2: 157. DOI: 10.29011/2575-7091.100057
Abstract
Scope: Most of commercial acai (Euterpe oleracea) beverages present a high glucose content, which could interfere with the potential beneficial effects of this berry.
Methods and Results: In the first study, we examined the effects of a commercial glucose-sweetened açai beverage upon lipid metabolism and adipokine plasma levels. In a second study, we studied the effects of a honey-sweetened açai beverage upon lipid profile, as well as oxidative status and cytokine expression. Rats were supplemented with both beverages for 6 weeks. The consumption of a glucose-sweetened açai beverage induced an increase in body weight gain and augmented visceral white adipose tissue mass, as well as higher plasma and liver triacylglycerol content. The consumption of the honey-sweetened açai beverage resulted in a reduction in TNF-alpha and an increase in IL-10 content, as well as reduced oxidative stress markers in the visceral white adipose tissue.
Conclusion: These data suggest an effect of the short-term consumption of a honey-sweetened açai beverage in preventing conditions characterized by chronic oxidative stress and inflammation. On the other hand, short-term consumption of an açai beverage containing a high glucose concentration, as that present in most commercially available beverages, leads to alteration of body composition, lipid and carbohydrate metabolism.
Keywords: Açai; Euterpe oleracea; Inflammation; Oxidative Stress; White Adipose Tissue
Abbreviations
Açai-H : Commercial Sugar-Sweetened Acai Beverage Group
Açai-S : Commercial Honey-Sweetened Acai Beverage Group
MDA : Molondialdehyde
MTP : Microsomal Triglyceride Transfer Protein
NFκB : Nuclear Factor Kappa B
TNF-alpha : Tumor Necrosis Factor Alpha
SREBP-2 : Sterol Regulatory Element Binding Transcription Factor
Introduction
Oxidative stress and inflammation are key features in a number of chronic diseases, most notably in those with metabolic alterations [1-3]. Epidemiological studies have identified fruits and vegetables as the key components of dietary patterns that reduce the risk for the development of chronic diseases, including cardiovascular disease, insulin resistance and type II diabetes and the incidence of many tumors [4-6].
Euterpe oleracea Martius is a large palm tree found in South America, especially in the Amazon. Its fruit, commonly known as açai, is a round, black-purple berry [7] and its pulp is traditionally consumed in Brazil. Açai has gained international attention as a functional food owing to its high content of polyphenols and potential health benefits [8].
Açai beneficial effects are related mainly to secondary metabolites such as flavonoids, including anthocyanins and proanthocyanidins, which provide antioxidant activity [9-11]. Several studies showed that açai consumption slows the progression of oxidative stress [12-16] and presents anti-inflammatory effect [9,14].
Although the açai compounds show positive health effects, most of the commercial beverages containing this berry also present high sugar content. The consumption of sugar-sweetened beverages has been associated with obesity and weight gain [15], impaired glucose and lipid metabolism and promotion of inflammation [16]. Therefore, the high glucose concentration in the açai juices could inhibit the described health effects of this fruit.
Based on this data, we investigated the effects of short-term consumption (6 weeks) of two different commercial açai beverages available in Brazil. First, we examined the effects of short-term consumption of a glucose-sweetened açai beverage on plasma lipid profile of rats. After detecting deleterious metabolic effects, we also studied the effects of short-term consumption of a commercial honey-sweetened açaí beverage in lipid profile, as well as in oxidative status and cytokine expression in the visceral white adipose tissue, liver and muscle.
Materials and Methods
Animals
Male adult Wistar rats obtained from the Institute of Biomedical Sciences, University of São Paulo, were maintained in metabolic cages, in a 12 h light:12 h dark cycle, under controlled temperature conditions (22 ± 2oC). Animals were acclimated to their environment for 1 week before the beginning of the experiment. The Ethical Committee for Animal Research from the University of São Paulo approved all the adopted procedures, which were carried out in accordance with the ethical principles stated by the Brazilian College of Animal Experimentation - Protocol n. 041/2005.
Experimental Design
Two studies were carried out in different moments. In both studies animals were randomly divided into 2 groups, a control group and an açai group. Control group received water and food (NuvilabCR1-Nuvital, Curitiba, Paraná, Brazil) ad libitum. Açai group received commercial açai beverage and food ad libitum (these animals had no acess to water).
Study 1: In the first study, animals received a commercial sugar-sweetened açai beverage (Açai-S), containing 40 % acai pulp, 15 % glucose, citric acid and water.
Study 2: Animals received a commercial honey-sweetened açai beverage (Açai-H), containing 70 % açai pulp, 18 % honey, 10 % acerola (Malpighia emarginata), 2 % lim (Citrus limon), 0.1 % powdered guarana seeds (Paulliniacupan) and water.
Açai beverages were always offered in dark bottles to maintain the sensory characteristics and to prevent oxidative processes. Animals were weighed 3 times per week, and their food and liquid intake was recorded daily. After six weeks in each treatment, animals were sacrificed by decapitation after 12 h fasting. Then, the weight of visceral white adipose tissue depots (epidydimal, retroperitoneal and mesenteric), liver and gastrocnemius muscles were measured. Blood and tissues were collected and immediately stored at - 80oC until the experiments were carried out.
Plasma Measurements and Liver Lipid Content Assessment
Blood plasma was isolated by centrifugation at 3,000 x g for 15 min and stored at - 80oC. Total cholesterol, HDL-cholesterol, triacylglycerol and glucose were quantified using commercial colorimetric kits (Labtest®, Brazil). Adiponectin and leptin plasma levels were determined by ELISA (Invitrogen, USA) and radioimmunoassay (LincoReasearch Inc., USA), respectively. Liver triacylglycerol content was assessed with the method described by Folch et al. [17].
Cytokines Protein Content Assessment
After euthanasia, the tissues (liver, gastrocnemius and visceral white adipose tissue depots) were rapidly removed and frozen. These tissues (0.1 - 0.3 g) were homogenized in a RIPA buffer (0.625% Nonidet P-40, 0.625% sodium deoxycholate, 6.25 mM sodium phosphate, and 1 mM ethylene-diamine tetra acetic acid at pH 7.4) containing 10 μg/ml of a protease inhibitor cocktail (Sigma-Aldrich, USA). Homogenates were centrifuged at 12,000 × g for 10 min at 4°C, the supernatant was saved, and the protein concentration was determined using a BCA protein assay reagent (Thermo Scientific, USA). Quantitative assessment of TNF-alpha (CRC3013), IL-6 (CRC0063) and IL-10 (CRC0103) proteins content was carried out by ELISA (Invitrogen, USA).
Thiobarbituric Acid Reactive Species (TBARS) Determination
As an index of lipid peroxidation in the tissues, we measured the formation of TBARS during an acid-heating reaction [18]. Briefly, tissue samples were mixed with 8.1% tricholoacetic acid (2.5 M, pH 3.4; Sigma, USA) and 0.8% thiobarbituric acid (Sigma, USA). The tubes were covered with aluminium foil and kept in a dry bath for 30 min, followed by centrifugation at 3,000 rpm for 10 min at 4oC. The absorbance of the supernatant was read at 532 nm with Malondialdehyde (MDA) as an external standard. Data are reported as mmol of MDA/mg of protein.
Real time PCR
Total RNA was obtained from aliquots of 100 mg of liver by Trizol® reagent extraction according to the manufacturer’s instructions. The primers used were: GLUT-2 [NM_012879.2] (sense TTAGCAACTGGGTCTGCAAT, antisense GGTGTAGTCCTACACTCATG); glycogen synthase 2 [NM_013089.1] (sense GTTTCCTGGGAAGTGACCAA, antisense CCATGTTTGTTCATGGCATC), SREBP-2 [NM_005106.4] (sense GGCCTGACAGGTGAAATCAG, antisense ATAGGGGGCATCAAATAGGC); MTP [NM_000253] (sense AATGACCGGCTGTACAAGCTCAC, antisense CCTTTGAAGATGCTCTTCTCTC); Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) [NM_017008.3] (sense AGACAGCCGCATCTTCTTGT, antisense CTTGCCGTGGGTAGAGTCAT). Quantitative real-time PCR was carried out with an ABI 7300 Real Time PCR Systems (Applied Biosystems) and the mRNA levels were determined by a comparative Ct method.
Statistical Analysis
Data are expressed as means ± s.e.m. Statistical analysis was performed using the Graph Pad Prism statistics software package version 5.0 for Windows. Results were analyzed by Student’s t test, followed by Tukey’s post-test. The 0.05 probability level was considered to indicate statistical significance.
Results
Study 1
Food and beverage intake
Food intake during the experimental period was decreased in Açai-S compared to Control (15.76 ± 0.04 g /day vs. 22.23 ± 0.88 g / day, respectively; p < 0.05). However, supplemented animals consumed 58.88 ± 0.52 mL / day of acai beverage. The beverage intake resulted in a higher total caloric intake by the supplemented rats (103.75 ± 1.77 kcal/day vs. 75.61 ± 2.64 kcal/day; p< 0.05).
Body and tissues relative weight gain
The increased caloric intake resulted in higher body weight gain in Açai-S compared to Control (Table 1). The weight of all visceral white adipose tissue depots and liver was increased in Açai-S (Table 1).
Triacylglyerol liver content and plasma measurements
The triacylglycerol liver content was augmented in supplemented rats (Açai-S = 74.34 ± 16.53 vs. C ± 3.82 mg triacylglycerol /mg of tissue, P<0.05). Similarly, triacylglycerol plasma levels were also higher in Açai-S than in (Table 2). Despite these negative effects, the chronic consumption of a sugar-sweetened commercial açai beverage promoted an increase in HDL-cholesterol plasma levels and there was no difference ion total cholesterol and glucose levels (Table 2).
The leptin plasma levels were augmented in the supplemented animals (Table 2), and positively correlated with body weight gain (r=0.6; p<0.05). Since plasma leptin levels are reported to be related with increases on adipose tissue mass this result was already expected. However, adiponectin plasma levels were surprisingly higher in supplemented rats (by 60%, p<0.05) (Table 2). Moreover, adiponectin plasma concentration was also positively correlated with body weight gain (r=0.7; p<0.05).
Gene expression
The liver plays a central role in glucose homeostasis and lipid metabolism; thereby we assessed the effects of short-term sugar-sweetened açcai beverage consumption on the expression of important key genes: GLUT-2, glycogen synthase-2, MTP and SREBP-2. Liver GLUT-2 and glycogen synthase-2 mRNA expression was reduced in Açai-S. Reduced GLUT-2 mRNA content in the liver has been associatewith insulin resistance in this tissue [10] and a decrease in glycogen synthase-2 gene expression suggests modulation of glucose homeostasis and possible impairment of hepatic glycogen synthesis. There were no alterations regarding the other studied genes (Figure 1).
Study 2
Food and beverage intake
Food intake during the experimental period was decreased in Açai-H, when compared with control (14.27 ± 0.37g/day vs. 20.75 ± 1.14g/day, respectively; p<0.05). Moreover, supplemented rats consumed 84.24 ± 3.72 mL of açai beverage per day. When total drink and food consumption was analysed, Açai-H showed higher total caloric intake than the rats (107.29 ± 3.20 Kccal/day vs. 70.66 ± 275 Kcal/day, respectively; p<0.05).
Body and tissues relative weight gain
Despite the Açai-H augmented caloric intake, both groups showed similar body weight gain (Table 1). Similarly, no differences were found regarding the relative weight of liver, retroperitonial white adipose tissue and mesenteric white adipose tissue, after the experimental period (Table 1). Açai beverage consumption presented solely an effect on the relative weight of the epididymal white adipose tissue and of the gastrocnemius. It is important to note that some supplemented rats showed moderate diarrhea episodes in the first week of supplementation, which was completely abolished along the following week.
Plasma measurements
Table 2 shows the plasma lipid profile, as well as glucose, leptin and adiponectin plasma concentration. There was no difference between the groups regarding all these measurements.
Cytokine protein expression
To assess the possible anti-inflammatory role of the açai beverage we measured cytokine expression in the visceral white adipose tissue (retroperitoneal, epididymal and mesenteric pads), liver and gastrocnemius. The protein content of IL-6 and TNF-alpha, two important inflammatory cytokines, as well as of IL-10, the major anti-inflammatory cytokine, is described in Table 3. Cytokine expression showed depot-specific responses inin the white adipose tissue in Açai-H. In the retroperitoneal depot, a reduced TNF-alpha expression was observed, resulting in a modified IL10/TNF-alpha ratio. Moreover, IL-10 levels were increased by 56 % in the mesenteric white adipose tissue of Açai-H.
Thiobarbituric acid reactive species (TBARS)
Many studies have shown that the açai fruit presents in vitro [9,19] and in vivo [20,21] antioxidant capacity. Therefore, lipid peroxidation in the visceral white adipose tissue pads, liver and gastrocnemius was assessed (Figure 2). Açai-H had a significant reduction in TBARS formation in the retroperitoneal white adipose tissue and epididymal white adipose tissue of4 9.75 % and 44.90 % respectively (p<0.05), in relation to the Control.
Discussion
Açai is one of the Amazon´s most popular functional foods and widely consumed in the world [22]. Commercial açai beverages claim to have health benefits due to the antioxidant and anti-inflammatory properties of this fruit. However, our results show that the benefits of consuming these beverages depends on the sweetener used.
We demonstrated that short-term consumption of a honey-sweetened açai beverage is able to modulate cytokine levels in the visceral white adipose tissue, in a depot-specific manner. Results also revealed that this supplementation was able to reduce oxidative stress markers in two visceral white adipose tissue pads.
White adipose tissue is an important endocrine organ being involved in the regulation of many pathological processes [23]. The white adipose tissue is able to secrete a plethora of factors, including cytokines (e.g. TNF-alpha, IL-10, IL-6) and hormones (e.g. leptin and adiponectin), acting locally and distally, with autocrine, paracrine and endocrine action [24]. Several morpho-functionaldifferences have been reported among intra-abdominal visceral white adipose tissue and peripheral subcutaneous white adipose tissue [25]. Visceral adipose tissue secretes higher amounts of pro-inflammatory cytokines, such as TNF- alpha and IL-6, which are associated with many disease conditions (e.g. obesity, metabolic syndrome, diabetes, etc.).
Short-term consumption of a commercial honey-sweetened açai beverage induced an increase in IL-10 protein content in the mesenteric white adipose tissue, as well as a reduction in TNF-alpha protein levels in the retroperitoneal pad. Moreover, the reduced TNF-alpha expression in the retroperitoneal depot resulted in a modified IL-10/TNF-alpha ratio. Consistent with our observation, Xie et al. [14] showed a reduction on serum levels, gene expression and protein levels of TNF-alpha and IL-6 in resident macrophages from mice fed with açai. Other authors also described that oral administration of an açai stone extract reduced the increase in TNF-alpha expression in the lung of animals exposed to cigarette smoke [26]. Furthermore, a recent research described that açai frozen pulp ingestion prevented increase in IL-1beta, IL-18 and TNF-alpha, reducing the carbon tetrachloride-induced damage in rat brain tissue [27].
TNF-alpha is the most-studied cytokine in white adipose tissue. This cytokine is involved in metabolic, physiological and immunological regulation in this tissue, acting as a mediator of inflammation. On the other hand, IL-10 secreted by adipocytes, white adipose tissue stromal vascular fraction and tissue matrix, inhibits the production of several cytokines, such as TNF-alpha, IL-1beta and IL-6 [28]. IL-10/TNF-alpha ratio has been adopted as an indicator of the inflammatory status and disease-associated morbidity, with lower values associated with poorer prognoses [29].
Açai has been reported to contain many bioactive compounds. Major polyphenolic components in açai pulp include anthocyanins, proanthocyanidins, other flavonoids and lignans [30,31]. Among them, the flavonoids were found to be the major polyphenols. Flavonoids from açai pulp present anti-inflammatory effects at least in part through inhibition of NF-kB activation [32] and by modulating the Toll-Like Receptor-4 (TLR-4) and NF-kB protein expression [33]. NF-kB is a key mediator of inflammation in adipocyte cells and studies have shown a close relationship between TLR-4 and the activation of the NF-κB pathway, which leads to the elevation of pro-inflammatory adipokine genes and protein expression in adipose tissues [34,35].
Flavonoids have been shown, as a group, to exhibit strong antioxidant capacities. The mechanism responsible for the antioxidant activity of flavonoids involves the direct scavenging or quenching of oxygen free radicals or excited oxygen species, as well as the inhibition of oxidative enzymes that generate these reactive oxygen species [36]. We found lower MDA levels in two visceral white adipose tissue pads (retroperitoneal and epididymal) in Açai-H. Studies have shown a similar reduction in MDA content in different tissues of animals treated with anthocyanins or proanthocyanidins- rich fruit extracts [37-39]. Moreover, the açai antioxidant effect was previously shown in the serum and in the liver of ApoE deficient mice [14], in the serum of healthy adults [10] and liver of mice fed with a high-fat diet [8].
The improvement of anti-inflammatory/antioxidant profile of all visceral white adipose tissue depots indicates a protective effect of the short-term honey-sweetened commercial açai beverage consumption against chronic diseases. It is interesting to note that even with the higher epididymal white adipose tissue absolute and relative weight, the Açai-H cytokine profile was not altered. In addition, the MDA content was increased in this tissue.
Adipokines play a role in a wide variety of physiological and pathological process, including immunity and inflammation, in addition to having significant effects on metabolism. Among them, leptin and adiponectin are the most widely investigated. Leptin has a pivotal role in the control of food intake and plasma leptin levels are related with increases on adipose tissue mass. Therefore, an increase in leptin plasma levels only in Açai-S was already expected. Adiponectin is an anti-inflammatory and insulin-sensitising adipokine, playing a central role in glucose and lipid metabolism [40]. Considering that generally adiponectin plasma levels are inversely correlated with body weight, the increased adiponectin plasma level in Açai-S are very intriguing. Studies have reported that chronic consumption of procyanidins or plant sterols, both compounds present in açai, is able to modulate inflammation and oxidative stress by reducing inflammatory markers and increasing adiponectin plasma levels [41-43]. We hypothesize that this increase in adiponectin plasma levels could be a physiological response to counteract the inflammatory profile induced by the consumption of a glucose-rich beverage. In this respect, a recent study described a similar increase in adiponectin serum levels of rats fed with a high glucose diet [44]. The authors suggest that this effect is due to the pro-inflammatory microenvironment of the adipose tissue of these rats.
Diets rich in sucrose have been strongly associated with an increased prevalence of obesity, type 2 diabetes and cardiovascular risk factors. High sucrose feeding is able to induce steatosis, hepatic insulin resistance and hypertriglyceridemia [44,45]. In this study, the short-term consumption of a glucose-sweetened açai beverage resulted in high liver and plasma triacylglycerol content. Despite these negative effects, Açai-S animals showed increase in HDL-cholesterol plasma levels. Similarly, an increase in HDL-cholesterol in apolipoprotein deficient mice fed with açai was previously described [14]. On the other hand, the consumption of the honey-sweetened açai beverage failed to show any improvement on plasma lipid profile. Some studies reported açaihypocholesterolemic effect in pathological conditions [7,14,20]. Thus, it could be possible that the beneficial effect of açai is more pronounced when some alteration in plasma lipid profile is present.
The liver is the primary organ responsible for glycogen and lipid metabolism. Biosynthesis of glycogen and lipids is the primary means by which the body stores excess nutrients. Under normal conditions, glycogen is the primary storage form of excess energy. Glycogen production is regulated primarily via enzymes such as glycogen synthase [46]. The reduction in the glycogen synthase and GLUT-2 gene expression observed in Açai-S indicates impaired liver glucose metabolism in these animals. Enhanced lipogenesis and decreased glycogen synthesis are hallmarks of hepatic insulin-resistance, which might subsequently lead to the development of type 2 diabetes mellitus [47]. Adipose tissue physiology is an important contributor to the regulation of insulin resistance and fatty liver disease [46]. Many of the interactions among adipose tissue, insulin resistance, and hepatic steatosis are orchestrated by adipokines. Adiponectin expression was associated with the up-regulation of insulin-sensitizing genes in the liver (i.e., GLUT-2 and PPARγ) in an obesity model of insulin resistance [48]. Therefore, we can hypothesize that the increase in adiponectin plasma levels could be a physiological response to counteract not only the inflammatory response, but, as well the disruption in liver glucose metabolism induced by the consumption of a glucose-rich beverage.
It is important to note that commercial beverages used in our study contained other bioactive compounds besides açai. Antioxidant effects have been described for acerola (Malpighia emarginata) [49,50], lime (Citrus limon) [51], guarana (Paulliniacupana) [52] and honey [53]. Interestingly, a recent study showed that the intake of acerola juice decreased the level of inflammatory proteins in the adipose tissue of obese rats [54]. The antioxidant effect of acerola is attributed to the high vitamin C level, as well as to the polyphenols content in this fruit [49]. In addition, guarana also exhibits an important stimulant property because of its high caffeine content [55]. Açai-H animals had a higher caloric intake, but the weight gain during the experimental period was similar to control animals. We can speculate that the presence of guarana in the beverage could be responsible for such intriguing effect. Guarana has a high caffeine content, which varies from 3% to 6% in the dried seeds [56-60]. Numerous studies described the beneficial effect of caffeine on energy expenditure [61-65], therefore, it can potentially be considered as a body-weight regulator.
In summary, the short-term consumption of a honey-sweetened açai beverage was able to modulate cytokine levels and reduce oxidative stress markers in the visceral white adipose tissue, in a depot-specific manner. These data suggest a protective effect of the short-term consumption of a honey-sweetened açai beverage against conditions characterized by oxidative stress and inflammation. Moreover, the short-term consumption of an açai beverage containing a high glucose concentration, as that present in most commercially available beverages, leads to alteration of body composition, lipid and carbohydrate metabolism. Nevertheless, the consumption of this beverage interestingly induced an enhancement in adiponectin plasma levels, which could represent a compensatory response aimed at controlling the metabolic disruption induced by supplementation.
Author Contributions
R.X.N., F.O.R., M.J.A. and R.G.C. carried out all animal studies; R.S., A.F.A.M. and E.C. designed the study; R.S. and M.S. have written the manuscript; M.S. has supervised the study.
The study was financially supported by FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo) grant number 2012/50079-0 and CAPES (Coordenação de Aperfeiçoamento de Nível Superior).
“The authors have declared no conflicts of interest”.
Figure 1: Gene expression of genes related to lipid and glucose metabolism in the liver of animals supplemented with a commercial glucose-sweetened açcai beverage and control (study 1). Data are mean ± s.e.m. (n = 8 - 12). * P < 0.05.
Figure 2: Malondialdehyde (MDA) concentration in the visceral white adipose tissue depots (retroperitoneal, epidydimal and mesenteric), liver and muscle of animals supplemented with a commercial honey-sweetened acai beverage and its control (study 2). Data are mean ± s.e.m. (n = 6 - 10). RPAT: retroperitoneal white adipose tissue, EAT: epididymal white adipose tissue, MEAT: mesenteric white adipose tissue. * P< 0.05.
|
|
Study 1 |
Study 2 |
|||
|
|
Control |
Açai-S |
Control |
Açai-H |
|
|
Final body weight (g) |
223.00 ± 5.34 |
243.58 ± 5.37 |
261.13 ± 3.69 |
265.34 ± 1.74 |
|
|
Body weight gain (g) |
32.93 ± 2.98 |
51.16 ± 3.03a |
64.38 ± 7.89 |
65.78 ± 6.69 |
|
|
Relative body weight gain (%) |
17.35 ± 1.56 |
26.66 ± 1.60 a |
35.01 ± 4.58 |
34.27 ± 5.14 |
|
|
Tissues absolute weight (g) |
|||||
|
Mesenteric adipose tissue (g) |
1.04 ± 0.08 |
1.56 ± 0.14 a |
1.01 ± 0.09 |
1.08 ± 0.09 |
|
|
Retroperitoneal adipose tissue (g) |
1.46 ± 0.16 |
2.92 ± 0.33 a |
1.91 ± 0.29 |
2.05 ± 0.20 |
|
|
Epididymal adipose tissue (g) |
1.51 ± 0.17 |
1.90 ± 0.12 a |
2.15 ± 0.15 |
2.53 ± 0.18 a |
|
|
Liver (g) |
6.32 ± 0.17 |
7.27 ± 0.29 a |
7.13 ± 0.27 |
7.42 ± 0.21 a |
|
|
Gastrocnemius (g) |
1.34 ± 0.05 |
1.41 ± 0.03 |
1.17 ± 0.18 |
1.37 ± 0.08 a |
|
|
Tissues relative weight (%) |
|||||
|
Mesenteric adipose tissue (%) |
0.40 ± 0.06 |
0.63 ± 0.04 a |
0.63 ± 0.04 a |
0.41 ± 0.03 |
|
|
Retroperitoneal adipose tissue (%) |
0.65 ± 0.07 |
1.18 ± 0.11 a |
0.73 ± 0.08 |
0.77 ± 0.07 |
|
|
Epididymal adipose tissue (%) |
0.78 ± 0.08 |
1.02 ± 0.06 a |
0.82 ± 0.03 |
0.95 ± 0.05 a |
|
|
Liver (%) |
2.83 ± 0.07 |
2.99 ± 0.11 a |
2.73 ± 0.07 |
2.79 ± 0.05 |
|
|
Gastrocnemius (g) |
0.60 ± 0.01 |
0.57 ± 0.02 |
0.45 ± 0.06 |
0.52 ± 0.03 a |
|
|
Data are mean ± s.e.m. n = 8 for control and n=12 for acai. aDifferent from the corresponding control (P<0.05). |
|||||
Table 1: Effects of short-term consumption of a commercial açcai beverage in body weight gain and tissues weight of experimental study groups.
|
|
Study 1 |
Study 2 |
||
|
|
Control |
Açai-S |
Control |
Açai-H |
|
Glucose (mg/dl) |
137.37 ± 9.97 |
144.25 ± 8.73 |
100.78 ± 3.23 |
96.64 ± 7.47 |
|
Triacylglycerol (mg/dl) |
54.55 ± 2.96 |
73.06 ± 4.16 a |
70.65 ± 7.25 |
75.87 ± 10.74 |
|
Total cholesterol (mg/dl) |
69.27 ± 3.76 |
76.10 ± 4.17 |
82.27 ± 2.49 |
88.59 ± 3.63 |
|
HDL – cholesterol (mg/dl) |
27.14 ± 2.65 |
34.82 ± 1.48 a |
38.46 ± 3.31 |
38.34 ± 1.91 |
|
Leptin (ng/ml) |
2.01 ± 0.15 |
3.11 ± 0.39 a |
1.59 ± 0.32 |
1.45 ± 0.15 |
|
Adiponectin (µg/ml) |
17.33 ± 0.76 |
27.78 ± 1.22 a |
22.42 ± 3.43 |
18.34 ± 1.39 |
|
Data are mean ± s.e.m. n = 8 - 10. aDifferent from the corresponding control (P<0.05). |
||||
Table 2: Effects of açai sweetened juice beverage short termc chronic consumption on glucose, lipid profile and adipokines plasma levels of experimental study groups.
|
|
Control |
Açai-H |
|
Retroperitoneal white adipose tissue |
||
|
IL-6 (ng.mg of protein-1) |
918.73 ± 338.63 |
374.34 ± 89.72 |
|
IL-10 (ng.mg of protein-1) |
156.77 ± 38.84 |
136.72 ± 9.62 |
|
TNF-alpha (pg.mg of protein-1) |
582.03 ± 104.32 |
213.84 ± 50.22 a |
|
IL-10/TNF-alpha ratio |
0.36 ± 0.02 |
1.10 ± 0.21 a |
|
Mesenteric white adipose tissue |
||
|
IL-6 (ng.mg of protein-1) |
26.09 ± 15.80 |
11.77 ± 1.78 |
|
IL-10 (ng.mg of protein-1) |
18.03 ± 6.37 |
28.14 ± 2.22 a |
|
TNF-alpha (pg.mg of protein-1) |
108.53 ± 33.57 |
196.74 ± 54.59 |
|
IL-10/TNF-alpha ratio |
0.17 ± 0.06 |
0.28 ± 0.07 |
|
Epidydimal white adipose tissue |
||
|
IL-6 (ng.mg of protein-1) |
96.86 ± 33.10 |
95.24 ± 17.87 |
|
IL-10 (ng.mg of protein-1) |
8.47 ± 2.22 |
10.57 ± 1.01 |
|
TNF-alpha (pg.mg of protein-1) |
53.51 ± 21.50 |
18.12 ± 9.58 |
|
IL-10/TNF-alpha ratio |
0.26 ± 0.12 |
0.93 ± 0.54 |
|
Liver |
||
|
IL-6 (ng.mg of protein-1) |
23.46 ± 1.85 |
23.44 ± 1.63 |
|
IL-10 (ng.mg of protein-1) |
5.28 ± 0.65 |
4.56 ± 0.24 |
|
TNF-alpha (pg.mg of protein-1) |
967.55 ± 109.98 |
930.03 ± 53.93 |
|
IL-10/TNF-alpha ratio |
0.54 ± 0.02 |
0.49 ± 0.02 |
|
Muscle |
||
|
IL-6 (ng.mg of protein-1) |
0.18 ± 0.03 |
0.21 ± 0.02 |
|
IL-10 (ng.mg of protein-1) |
0.11 ± 0.01 |
0.11 ± 0.01 |
|
TNF-alpha (pg.mg of protein-1) |
37.03 ± 3.49 |
40.26 ± 2.38 |
|
IL-10/TNF-alpha ratio |
0.31 ± 0.01 |
0.25 ± 0.02 |
|
Data are mean ± s.e.m. n = 8 - 10.aP< 0.05. |
||
Table 3: Cytokines (Il-10, TNF-alpha and IL-6) levels in the white adipose tissue, liver and gastrocnemius muscle of control and supplemented rats.
- Burton-Freeman B, Linares A, Hyson D, Kappagoda T (2010) Strawberry modulates LDL oxidation and postprandial lipemia in response to high-fat meal in overweight hyperlipidemic men and women. J Am Coll Nutr 29: 46-54.
- Deeb RS, Hajjar DP (2016) Repair Mechanisms in Oxidant-Driven Chronic Inflammatory Disease. Am J Pathol 186: 1736-1749.
- Luna-López A, González-Puertos VY, López-Diazguerrero NE, Königsberg M (2014) New considerations on hormetic response against oxidative stress. J Cell Commun Signal 8: 323-331.
- Sutliffe JT, Fuhrman JH, Carnot MJ, Beetham RM, Peddy MS (2016) Nutrient-dense, Plant-rich Dietary Intervention Effective at Reducing Cardiovascular Disease Risk Factors for Worksites: A Pilot Study. AlternTher Health Med, 22: 32-36.
- Chapman K, Havill M, Watson WL, Wellard L, Hughes C, et al. (2016) Time to address continued poor vegetable intake in Australia for prevention of chronic disease. Appetite 107: 295-302.
- Diener A, Rohrmann S (2016) Associations of serum carotenoid concentrations and fruit or vegetable consumption with serum insulin-like growth factor (IGF)-1 and IGF binding protein-3 concentrations in the Third National Health and Nutrition Examination Survey (NHANES III). J Nutr Sci 5, e13.
- Udani JK, Singh BB, Singh VJ, Barrett ML (2011) Effects of Açai (Euterpe oleraceaMart.) berry preparation on metabolic parameters in a healthy overweight population: a pilot study. Nutr J 12: 10-45.
- de Oliveira PR, da Costa CA, de Bem GF, Cordeiro VS, Santos IB, et al. (2015) Euterpe oleraceaMart.-Derived Polyphenols Protect Mice from Diet-Induced Obesity and Fatty Liver by Regulating Hepatic Lipogenesis and Cholesterol Excretion. PLoS One 12.
- Schauss AG, Wu X, Prior RL, Ou B, Patel D, et al., (2006) Phytochemical and Nutrient Composition of the Freeze-Dried Amazonian Palm Berry, Euterpe oleraceae Mart. (Acai) J Agric Food Chem 54: 8598-8603.
- Jensen GS, Wu X, Patterson KM, Barnes J, et al. (2008) In vitro and invivo antioxidant and anti-inflammatory capacities of an antioxidant-rich fruit and berry juice blend. Results of a pilot and randomized, double-blinded, placebo-controlled, crossover study. J Agric Food Chem 56: 8326-8333.
- Marcason W (2009) What is the açaí berry and are there health benefits? J Am Diet Assoc 109: 1968.
- Guerra JF, Magalhães CL, Costa DC, Silva ME, Pedrosa ML (2011) Dietary açai modulates ROS production by neutrophils and gene expression of liver antioxidant enzymes in rats. J ClinBiochemNutr 49: 188-194.
- BonomoLde F, Silva DN, Boasquivis PF, Paiva FA, Ghuerra JF, et al. (2014) Açaí (Euterpe oleraceaMart.) modulates oxidative stress resistance in Caenorhabditis elegans by direct and indirect mechanisms. PLoS One 9: e89933.
- da Silva CCV, de Bem GF, da Costa CA, Santos IB, de Carvalho LC, et al., (2017) Euterpe oleraceaMart. seed extract protects against renal injury in diabetic and spontaneously hypertensive rats: role of inflammation and oxidative stress. Eur J Nutr 20.
- El Morsy EM, Ahmed MA, Ahmed AA (2015) Attenuation of renal ischemia/reperfusion injury by açaí extract preconditioning in a rat model. Life Sci 123: 35-42.
- Poulose SM, Bielinski DF, Carey A, Schauss AG, Shukitt-Hale B (2017) Modulation of oxidative stress, inflammation, autophagy and expression of Nrf2 in hippocampus and frontal cortex of rats fed with açaí-enriched diets. NutrNeurosci 20: 305-315.
- Noratto GD, Angel-Morales G, Talcott ST, Mertens-Talcott SU (2011) Polyphenolics from açaí (Euterpe oleraceaMart.) and red muscadine grape (Vitisrotundifolia) protect Human Umbilical Vascular Endothelial Cells (HUVEC) from glucose- and lipopolysaccharide (LPS)-induced inflammation and target microRNA-126. J Agric Food Chem59: 7999-8012.
- Xie C, Kang J, Burris R, Ferguson ME, Schauss AG, et al., (2011) Açaí juice attenuates atherosclerosis in ApoE deficient mice through antioxidant and anti-inflammatory activities. Atherosclerosis 216: 327-333.
- Brunkwall L, Chen Y, Hindy G, Rukh G, Ullrika Ericson, et al., (2016) Sugar-sweetened beverage consumption and genetic predisposition to obesity in 2 Swedish cohorts. Am J ClinNutr 104: 809-815.
- Aeberli I, Gerber PA, Hochuli M, Kohler S, Haile SR, et al., (2011) Low to moderate sugar-sweetened beverage consumption impairs glucose and lipid metabolism and promotes inflammation in healthy young men: a randomized controlled trial. Am J ClinNutr 94: 479-485.
- Folch J, Lees M, Sloane Stanley GH (1957) A simple method for the isolation and purification of total lipides from animal tissues. J BiolChem 226: 497-509.
- Emara AM, El-Bahrawy H (208) Green tea attenuates benzene-induced oxidative stress in pump workers. J Immunotoxicol 5: 69-80.
- Lichtenthäler R, Rodrigues RB, Maia JG, Papagiannopoulos M, Fabricius H, et al. (2005) Total oxidant scavenging capacities of Euterpe oleraceaMart. (Acai) fruits. Int J Food Sci Nutr 56: 53-64.
- de Souza MO, Silva M, Silva ME, Oliveira Rde P, Pedrosa ML (2010) Diet supplementation with acai (Euterpe oleraceaMart.) pulp improves biomarkers of oxidative stress and the serum lipid profile in rats. Nutrition 26: 804-810.
- Mertens-Talcott SU, Rios J, Jilma-Stohlawetz P, Pacheco-Palencia LA, Meibohm B, et al. (2008) Pharmacokinetics of anthocyanins and antioxidant effects after the consumption of anthocyanin-rich acai juice and pulp (Euterpe oleraceaMart.) in human healthy volunteers. J Agric Food Chem 56: 7796-7802.
- Yamaguchi KK, Pereira LF, Lamarão CV, Lima ES, da Veiga-Junior VF (2015) Amazon acai: chemistry and biological activities: a review. Food Chem 15: 137-151.
- Trayhurn P, Wood IS (2005) Signaling role of adipose tissue: adipokines and inflammation in obesity. BiochemSoc Trans 33: 1078-1081.
- Pond CM (1999) Physiological specialization of adipose tissue. Prog Lipid Res 38: 225-248.
- Kwok KH, Lam KS, Xu A (2016) Heterogeneity of white adipose tissue: molecular basis and clinical implications. ExpMol Med 48: e215.
- Moura RS, Ferreira TS, Lopes AA, Pires KM, Nesi RT, et al. (2012) Effects of Euterpe oleraceaMart. (AÇAÍ) extract in acute lung inflammation induced by cigarette smoke in the mouse. Phytomedicine 19: 262-269.
- de Souza Machado F, Marinho JP, Abujamra AL, Dani C, Quincozes-Santos A, et al. (2015) Carbon Tetrachloride Increases the Pro-inflammatory Cytokines Levels in Different Brain Areas of Wistar Rats: The Protective Effect of Acai Frozen Pulp. Neurochem Res 40: 1976-1983.
- Schottelius AJ, Mayo MW, Sartor RB, Baldwin AS Jr (1999) Interleukin-10 signaling blocks inhibitor of kappaB kinase activity and nuclear factor kappaB DNA binding. J BiolChem 274: 31868-31874.
- Leonidou L, Mouzaki A, Michalaki M, DeLastic AL, Kyriazopoulou V, et al. (2007) Cytokine production and hospital mortality in patients with sepsis-induced stress hyperglycemia. J Infect 55: 340-346.
- Chin YW, Chai HB, Keller WJ, Kinghorn AD (2008) Lignans and other constituents of the fruits of Euterpe oleracea(Acai) with antioxidant and cytoprotective activities. J Agric Food Chem 56: 7759-7764.
- Schauss AG, Wu X, Prior RL, Ou B, Patel D, et al. (2006) Phytochemical and nutrient composition of the freeze-dried amazonian palm berry, Euterpe oleraceae mart. (acai). J Agric Food Chem 54: 8598-8603.
- Kang J, Xie C, Li Z, Nagarajan S, Schauss AG, et al. (2011) Flavonoids from acai (Euterpe oleraceaMart.) pulp and their antioxidant and anti-inflammatory activities. Food Chem 128: 152-157.
- Dias MM, Martino HS, Noratto G, Roque-Andrade A, Stringheta PC, et al. (2015) Anti-inflammatory activity of polyphenolics from açai (Euterpe oleraceaMartius) in intestinal myofibroblasts CCD-18Co cells. Food Funct 6: 3249-3256.
- Lira FS, Rosa JC, Pimentel GD, Seelaender M, Damaso AR, et al. (2012) Both adiponectin and interleukin-10 inhibit LPS-induced activation of the NF-κB pathway in 3T3-L1 adipocytes. Cytokine 57: 98-106.
- Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara SM, et al. (2007) Loss-of-function mutation in Toll-like receptor 4 prevents diet-induced obesity and insulin resistance. Diabetes 56: 1986-1998.
- Terao J (2009) Dietary flavonoids as antioxidants. Forum of Nutrition 61: 87-94.
- Alvarez-Suarez JM, Dekanski D, RistićS, Radonjić NV, Petronijević ND, et al. (2011) Strawberry polyphenols attenuate ethanol-induced gastric lesions in rats by activation of antioxidant enzymes and attenuation of MDA increase. PLoS One 6: e25878.
- Li WG, Zhang XY, Wu YJ, Tian X (2001) Anti-inflammatory effect and mechanism of proanthocyanidins from grape seeds. Acta Pharmacol Sin 22: 1117-1120.
- Yamakoshi J, Kataoka S, Koga T, Ariga T (1999) Proanthocyanidin-rich extract from grape seeds attenuates the development of aortic atherosclerosis in cholesterol-fed rabbits. Atherosclerosis 142: 139-149.
- Ouchi N, Walsh K (2007) Adiponectin as an anti-inflammatory factor. ClinChim Acta 380: 24-30.
- Micallef MA, Garg ML (2009) Anti-inflammatory and cardioprotective effects of n-3 polyunsaturated fatty acids and plant sterols in hyperlipidemic individuals. Atherosclerosis 204: 476-482.
- Terra X, Montagut G, Bustos M, Llopiz N, Ardèvol A, et al. (2009) Grape-seed procyanidins prevent low-grade inflammation by modulating cytokine expression in rats fed a high-fat diet. J NutrBiochem 20: 210-218.
- Décordé K, Teissèdre PL, Auger C, Cristol JP, Rouanet JM (2008) Phenolics from purple grape, apple, purple grape juice and apple juice prevent early atherosclerosis induced by an atherogenic diet in hamsters. MolNutr Food Res 52: 400-407.
- Castellanos Jankiewicz AK, Rodríguez Peredo SM, Cardoso Saldaña G, Díaz Díaz E, et al. (2015) Adipose tissue redistribution caused by an early consumption of a high sucrose diet in a rat model. Nutr Hosp 31: 2546-2553.
- Huang W, Metlakunta A, Dedousis N, Zhang P, Sipula I, et al. (2010) Depletion of liver Kupffer cells prevents the development of diet-induced hepatic steatosis and insulin resistance. Diabetes 59: 347-357.
- Roach PJ, Depaoli-Roach AA, Hurley TD, Tagliabracci VS (2012) Glycogen and its metabolism: some new developments and old themes. Biochem J 441: 763-787.
- Saltiel AR, Kahn CR (2001) Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414: 799-806.
- González-Périz A, Horrillo R, Ferré N, Gronert K, Dong B, et al. (2009) Obesity-induced insulin resistance and hepatic steatosis are alleviated by omega-3 fatty acids: a role for resolvins and protectins. FASEB J 23: 1946-1957.
- Oliveira Lde S, Moura CF, De Brito ES, Mamede RV, De Miranda MR (2012) Antioxidant metabolism during fruit development of different acerola (Malpighia emarginata D.C) clones. J Agric Food Chem 60: 7957-7964.
- Nunes Rda S, Kahl VF, SarmentoMda S, Richter MF, Costa-Lotufo LV, et al. (2011) Antigenotoxicity and antioxidant activity of Acerola fruit (Malpighia glabra L.) at two stages of ripeness. Plant Foods Hum Nutr 66: 129-135.
- Rauf A, Uddin G, Ali J (2014) Phytochemical analysis and radical scavenging profile of juices of Citrus sinensis,Citrus anrantifolia, and Citrus limonum. Org Med Chem Lett 4: 5.
- Yonekura L, Martins CA, Sampaio GR, Monteiro MP, César LA, et al. (2016) Bioavailability of catechins from guaraná (Paulliniacupana) and its effect on antioxidant enzymes and other oxidative stress markers in healthy human subjects. Food Funct 7: 2970-2978.
- Zoheir KM, Harisa GI, Abo-Salem OM, Ahmad SF (2015) Honey bee is a potential antioxidant against cyclophosphamide-induced genotoxicity in albino male mice. Pak J Pharm Sci 28: 973-981.
- Dias FM, Leffa DD, Daumann F, Marques SD, Luciano TF, et al. (2014) Acerola (Malpighia emarginata DC.) juice intake protects against alterations to proteins involved in inflammatory and lipolysis pathways in the adipose tissue of obese mice fed a cafeteria diet. Lipids Health Dis 13: 24.
- Schimpl FC, da Silva JF, Gonçalves JF, Mazzafera P (2013) Guarana: revisiting a highly caffeinated plant from the Amazon. J Ethnopharmacol 150: 14-31.
- Bempong DK, Houghton PJ (1992) Dissolution and absorption of caffeine from guarana. J Pharm Pharmacol 44: 769-771.
- Belza A, Toubro S, Astrup A (2009) The effect of caffeine, green tea and tyrosine on thermogenesis and energy intake. Eur J ClinNutr 63: 57-64.
- Bracco D, Ferrarra JM, Arnaud MJ, Jéquier E, Schutz Y (1995) Effects of caffeine on energy metabolism, heart rate, and methylxanthine metabolism in lean and obese women. Am J Physiol 269: 671-678.
- Yoshioka M, Doucet E, Drapeau V, Dionne I, Tremblay A (2001) Combined effects of red pepper and caffeine consumption on 24 h energy balance in subjects given free access to foods. Br J Nutr 85: 203-211.
- Schubert MM, Hall S, Leveritt M, Grant G, Sabapathy S, et al. (1985) Caffeine consumption around an exercise bout: effects on energy expenditure, energy intake, and exercise enjoyment. J ApplPhysiol 117: 745-754.
- Roberts AT, de Jonge-Levitan L, Parker CC, Greenway F (2005) The effect of an herbal supplement containing black tea and caffeine on metabolic parameters in humans. Altern Med Rev 10: 321-325.
- morpho-functionaldifferences have been reported among intra-abdominal visceral
white adipose tissue and peripheral subcutaneous white adipose tissue [25].
Visceral adipose tissue secretes
higher amounts of pro-inflammatory cytokines, such as TNF- alpha and IL-6, which are associated with many disease conditions (e.g. obesity, metabolic syndrome, diabetes, etc.).
© by the Authors & Gavin Publishers. This is an Open Access Journal Article Published Under Attribution-Share Alike CC BY-SA: Creative Commons Attribution-Share Alike 4.0 International License. Read More About Open Access Policy.