Introduction

As the first line of defence, skin forms an effective barrier between the organism and the environment fending off chemical and physical attacking and preventing pathogens invasion, also including the unregulated loss of water and other solutes [1,2]. The skin includes epidermis, dermis and subcutaneous tissue. The skin barrier function is mainly provided by the stratum corneum, with cells enriched of proteins, like cornified envelopes and cytoskeletal elements, and intercellular domains enriched of lipid.

This skin barrier is referred as a ‘brick and mortar’ structure. The structure contains the keratin microfibrils, filaggrin and cornified envelopes. All of these form the bricks. The lipids form the mortar [3]. The desmosomes form the tight, gap and adherens junctions. In simple epithelia, Tight Junctions (TJ) that contain claudins, occludin, and tight junction proteins which serve as a physical barrier to prevent solutes and water unregulated lossing through forming cell-cell junctions [4]. Proteins like loricrin (LOR), filaggrin (FLG), involucrin (IVL), Caspase-14 (CASP14), Bleomycin Hydrolase (BLMH), Ceramide Synthase 3 (CER3), Transglutaminase (TGM)-1 also contribute to the protective skin barrier [5-9].

Alterations in intercellular lipids and epidermal differentiation can lead to barrier defects, damage and, finally, skin disease. Decreasing the expression of Claudin-1 can result in significantly impaired in scratch wound healing, with delayed in cell migration and reduced in cell proliferation [10]. The TJ proteins, such as Claudin-1, Claudin -4, Occludin, and TJP1 contributed to the skin barrier to ions; Claudin -1 and TJP1 also contributed to the skin barrier to larger molecules on NHEKs models [11]. Claudin-5 (CLDN5) may which belong to claudins proteins which play an important role in the epidermal barrier with sensitive skin [12]. Compared to healthy skin models, knock downing FLG can lead to a disorganized skin lipid barrier and reduce the content of Uric Acid (UCA) and pyrrolidone carboxylic acid (PCA) [13]. The major protein of the epidermal cornified cell envelope is loricrin, approximately 70% by mass. Deficiency of loricrin protein leaded to a delay in the formation of the skin barrier in mice embryonic development [14]. Lossing of keratin 10 (CK10) expression can result in recessive epidermolytic ichthyosis, and then impaired barrier function [15,16]. Deficiency of ceramide synthase 3 (CER3) results in persistent periderm, hyperkeratosis. More seriously, losing ceramide synthase 3 can arrest keratinocyte maturation at an embryonic pre-barrier stage in mice [6]. Caspase14-deficient epidermis model can reduce skin-hydration levels and increased water loss [17]. These mean that TJ proteins, keratinized mantle protein, skin barrier protein and keratin have the important function to skin barrier.

Prinsepia utilis Royle is classified as the Rosaceae. It grows mainly in Yunnan province of China and finds in bushes at elevations of up to 1000-3000 m above sea level [18]. Prinsepia utilis has been used to treat skin diseases, rheumatism, inflammation, and leprosy in Chinese and Indian folk medicine. Prinsepia utilis contain hydrocyanic acid fatty oil, prinsepiol and triterpenoids [18]. The main fatty acids in the oil were palmitic acid (15.15 %), stearic acid (6.85 %), oleic acid (38.82 %), linoleic acid (37.15 %) and linolenic acid (1.13 %) [19]. Lipid composition in skin is one of the important structures of corneum barrier. Skin surface lipids such as free fatty acids (palmitic acid and oleic acid) maintain skin surface moisture permeability, moisture retention and barrier functions [20-22]. However, to date, there have been few studies of the function on Prinsepia Utilis Royle Oil (PURO), especially on skin barrier in reconstructed skin models or other in vitro models.

Here, we analyzed the ingredient of PURO by GC-MS. PURO mainly contain tetradecanoic acid, palmitic acid, palmitoleic acid, heptadecanoic acid, stearic acid, oleic acid, linoleic acid, linolenic acid, eicosanoic acid, eicosenoic acid. Therefore, we investigated whether the PURO have the function of skin barrier in a reconstructed human epidermis model. In our study, we find that PURO can affect the cell migration in HaCAT with the higher healing rate. The MTT and ELISA assay show that PURO have no skin irritation on reconstructed skin model. PURO can contribute to the barrier to Rhodamine B, enhance the skin barrier and reduce the skin permeability. The ET₅₀ data suggest that PURO maintain the barrier function on skin model. Following the topical treatment of PURO, immunofluorescence staining and QRT-PCR are used to investigate differentiation of epidermal structural components of barrier function. The results show that PURO can increase the expression of FLG, LOR, TJP1, CASP14, CER3, IVL, BLMH, TGM-1 and CLDN5 on SDS damaged skin model; the expression of FLG, IVL and LOR on normal skin model. We also find that PURO can inhibit the inflammatory factor such as IL-1α, IL-8 and PGE2. We consider that PURO have the function of enhance and repair skin barrier which may have contribution to Atopic Dermatitis (AD) patients.

Methods

Reconstructed Human Epidermis EpiSkin^®

A commercial epidermal tissue is EpiSkin^® (L’Oréal Research and Innovation Center, Shanghai, China), made from normal human keratinocytes. EpiSkin^® which is an in vitro reconstructed human epidermis that culture on a collagen matrix at the air-liquid interface. EpiSkin ^® are similar to those of in vivo human epidermis by histologic sections. After pre-incubation, tissues were treated with 0.3% SDS or PBS for 10 min. Then the tissues were washed by DPBS, as SDS damaged skin model or normal skin model. Then, the tissues exposure with 20 μl of various concentrations of PURO confect with Base material. After 24-48 h treatment, tissues were washed with DPBS.

HaCAT Cell Line

HaCAT cell line (National Infrastructure of Cell Line Resource) Cell scratch assay was performed by using in vitro scratch assay. HaCaT cells were cultured on 12-well plate at a density of 5×105 cells/well and incubated overnight at 37^°C. The wound area was scratched with Culture-Insert 2 Well in µ-Dish 35 mm. Then, the cells were treated with 5% and 10% of PURO diluted by DMSO on 0h, 16h and 24h. The method referred to Hanittinan [23].

Materials and Reagents

Prinsepia Utilis Royle Oil (PURO) was obtained from Yunnan Botanee Bio-technology Group Co., Ltd. (Yunnan, China). TritonX-100 solution was bought from Sangon Biotech (Shanghai,

China). Sodium lauryl sulfate (SDS) was obtained from SigmaAldrich (Saint Louis, MO, USA). Calcium/magnesium-free Dulbecco’s Phosphate-Buffered Saline (DPBS) was obtained from Basal Media (Shanghai, China). MTT (Methyl Thiazolyl Tetrazolium), DAPI (4,6-amidine-2-phenylindole), Rhodamine

B and Anti-fluorescent quench sealant was obtained from BIOLIGHT BIOTECH (Shanghai, China). IL-1α, IL-8 and PGE2 ELISA kits were purchased from NEOBIOSCIENCE (Shenzhen, China). The ingredient of Base, 5% PURO and 10% PURO formula were shown on supplemental Table S1.

NO.	Name
1	H2O
2	PEMULEN TR-1 POLYMER
3	PMX200-350cst
4	Moon K Glycerin
5	GRINDSTED Xanthan 200
6	GRESURF GMS165
7	Hydrolite-5/Purolan PD-LO
8	AMP-ULTRA PC 2000

Table S1: Base.

NO.	Name
1	H2O
2	PEMULEN TR-1 POLYMER
3	PMX200-350cst
4	Moon K Glycerin
5	GRINDSTED Xanthan 200
6	GRESURF GMS165
7	Hydrolite-5/Purolan PD-LO
8	AMP-ULTRA PC 2000
9	PURO

Table S1: PURO Formula.

Table S1: The ingredients of Base and PURO formula.

Skin Irritation

This method referred to Wang [24]. After overnight incubation (37 ^°C, 5.0% CO2), the EpiSkin^® models were used in the following experiments. After 18 h of post-exposure incubation with the PURO formula at 37^°C, 5.0% CO₂, the surface of the EpiSkin ^® was washed with DPBS. Then, using the MTT assay to detect the tissue activity and ELISA assay to detect the release of IL-1α/ IL-8 24.

Quantitative RT-PCR

Total RNA was extracted from the skin tissue using a TRIzol kit (Invitrogen) following the manual. According to the explanatory memorandum (Takara), first-strand complementary DNA (cDNA) was synthesized. Using a Roche LC96 (Roche) to perform quantitative RT-PCR with SYBR Green I master mix (Roche). The sequences of PCR primers were attached to Supplemental Table S2. The RT-qPCR results are shown as the relative expression levels normalized to the expression of β-Acting, which was used as an internal reference (β-Acting -F/R), and three biological replicates were included for every experiment.

CK10-F	CAACTCACATCAGGGGGAGC
CK10-R	CAGCTCATCCAGCACCCTAC
CK14-F	AGATGATTGGCAGCGTGGA
CK14-R	ACATCTCTGGATGACTGCGA
IL1a-F	ACTCAATTGTATGTGACTGCCCAAG
IL1a-R	TGGTCTCACTACCTGTGATGGTTT
CLDN5-F	CCTTCCCTGATGTCTGATTTTTG
CLDN5-R	GCCTCTTCTCCCATTTGTTTTTC
DSG1-F	CACTCAGATTGTGCTGCAAAC
DSG1-R	CATCTGCCCCACCATCTC
TJP-1-F	GGGACAACAGCATCCTTCCA
TJP-1-R	GCAAAAGACCAACCGTCAGG
AQP3-F	CCCTGGATCAAGCTGCCCATCTA
AQP3-R	GGCGAAGTGCCAGATTGCAT
IL8-F	GCTCTCTTGGCAGCCTTCC
IL8-R	CAGAGCTCTCTTCCATCAGAAAGCT
Acting-F	GCAAAGACCTGTACGCCAAC
Acting-R	GATCTTCATTGTGCTGGGTGC
FLG-F	GAGGGCACTGAAAGGCAAAA
FLG-R	CTTCCGTGCTGAGAGTGTCT
LOR-F	CCAGACCCAGCAGAAGCAG
LOR-R	TGCCCCTGGAAAACACCTC
TGM1-F	GAGAGCACCACACAGACGAG
TGM1-R	CTCGGGGTTGTTTCCGATGA
CER3-F	ACATTCCACAAGGCAACCATTG
CER3-R	CTCTTGATTCCGCCGACTCC
CASP14-F	GACCTGGATGCTCTGGAACACA
CASP14-R	GAATCGATGGCCTGCTGGA
BLMH-F	TGTGGTTTGGCTGTGATGTT
BLMH-R	GCACCATCCTGATCATCCTT
IVL-F	CCATCAGGAGCAAATGAAACAG
IVL-R	GCTCGACAGGCACCTTCTG

Table S2: The list of primers that used in Quantitative RT-PCR.

Skin Penetration Study

Rhodamine B is a hydrophilic dye. Using Rhodamine B to evaluate the permeability of the skin [25]. EpiSkin^® or SDS damaged skin model was treated with PURO formula for 24 h and washed with PBS 0.02% rhodamine B was treated for 1h. The tissues were fixed in 4% paraformaldehyde for 20 min at 4^°C. Then the tissues were washed in 0.01 mol/L PBS for 5 min. After that, the tissues were dehydrated in an ethanol gradient, and then vitrified by xylene, immersed and embedded in wax overnight. Using a Leica rotary microtome (RM2235, Germany) to slice up the tissue. The sections were 5 μm thick. The slices were dewaxed by xylene, rehydrated in an ethanol gradient, washed in 1×PBS two times for 3 min respectively. After 2 times washing, 1000 times diluted DAPI in 1× PBS were treated on slides, followed by 3 washes in PBS. In the end, samples were covered by anti-fluorescent quench sealant and immunofluorescence images were captured by ZESS microscopic examination (Axio Scope, Germany).

UV Irradiation

After pre-incubation, tissues were treated with UVB=90mJ or dark. Then, the tissues exposure with 20 μl of various concentrations of PURO confect with Base material. After 42 h treatment, tissues were washed with DPBS. The medium are diluted to measure the release of PGE2 by using the ELISA kit.

MTT Assay

This method referred to Wang [24].

ELISA Assay

The test media were diluted to measure the release of IL1α/ IL-8/PGE2 by using the ELISA kit. The relative expression of IL-1α/ IL-8 release are compared to untreated EpiSkin^® samples (controls).

ET50

The skin model was pretreated with samples (10%PURO formula and Base) with 0.2%SDS working solution. After 24h treatment, tissues were rinsed with DPBS. Then, the tissues were treated with 1% TritonX100 with 0min, 5min, 20min and 30min. After rinsing with DPBS, the tissues were incubated for 24 h at 37^°C, 5.0% CO₂. After that, the tissues were detected by MTT assay. Furthermore, calculating ET₅₀ by SPSS software. ET₅₀ means that the time required for 50% tissue activity.

Immunofluorescence Staining (IF)

For immunofluorescence, skin samples were cut into 5 μm section. The slices were proceeded rehydration steps with descending graded series of ethanol. The sections were incubated in boiled citrate buffer (pH 6.4) for 20 min and then cooled to room temperature. The slides were washed three times in PBS (pH

7.4) for 5 min. Then, the sections were blocked with 1.5% BSA + 0.025% TritonX-100 in PBS for 30 min to 90 min. Anti-Filaggrin (abcam ab81468 1:1000)/ Anti-Loricrin (abcam ab85679 1:200)/ Anti-Cytokeratin 10 (abcam ab111447 1:200) were diluted in blocking buffer, and the slides were then incubated at 4^°C overnight or 1-2h at room temperature. Then, the slides were washed three times in PBS (pH 7.4) for 5 min and incubated with Goat AntiRabbit IgG H&L (FITC) diluted 1:2500 in PBS (pH 7.4) for 1 h at room temperature. Then, washing three times in PBS for 5 min, and DAPI were treated on slides, followed by three washes in PBS for 5min. Samples were covered by anti-fluorescent quench sealant. Using ZESS microscopic examination (Axio Scope, Germany) to capture the immunofluorescence images.

Gas Chromatography-Mass Spectrometry (GC-MS)

Qualitative and quantitative determination of Prinsepia Utilis Royle oil (PURO) by Gas Chromatography-Mass Spectrometry: The PURO was identified by gas chromatographymass spectrometry (GC-MS). The determination conditions were Agilent 7890A GC-7000MS. The chromatographic column was Agilent VF-WAX 60 m×0.25 mm×0.25 μm, and the ion source type was EI. 230^°C, heating procedure: the initial temperature is 100^°C, and the temperature is heated to 240^°C at the rate of 10^°C / min for 70 min.

Statistical Analysis

The statistical significance was determined with Two way ANOVA (p < 0.05 was considered to be statistically significant).

Results

Analysis of Main Components of PURO

Here, we use GC-MS to analyze the main components of PURO. The most abundant of PURO are palmitic acid, oleic acid and linoleic acid. The time-to-Peak force of palmitic acid is 21.675-21.853min, oleic acid is 26.385-26.743min, linoleic acid is 27.751-28.104min (Figure 1a and supplemental Figure S1a-c). The ingredient of PURO is tetradecanoic acid (0.1%), palmitic acid (17.9%), palmitoleic acid (0.4%), heptadecanoic acid (0.1%), stearic acid (9.1%), oleic acid (36.5%), linoleic acid (33.1%), linolenic acid (1.1%), eicosanoic acid (0.7%), eicosenoic acid (0.2%) (Figure 1a and b). The most abundant of these are palmitic acid, oleic acid and linoleic acid which belong to seburm free fatty acids that have the function of skin barrier and skin moisturizing [21,22,26].

 

Figure1: Component analysis of PURO

Figure 1a: The Integration Peak of PURO. The abscissa axis is counts vs Acquisition time. The y-axis is TIC Scan. Figure 1b: The composition and content of PURO. The ingredient of PURO is tetradecanoic acid (0.1%), palmitic acid (17.9%), palmitoleic acid (0.4%), heptadecanoic acid (0.1%), stearic acid (9.1%), oleic acid (36.5%), linoleic acid (33.1%), linolenic acid (1.1%), eicosanoic acid (0.7%), eicosenoic acid (0.2%), others (0.8%).

Oils with a higher linoleic acid to oleic acid ratio have better barrier repair potential [27]. Palmitic acid has a direct and pronounced effect on epidermal morphogenesis via activating the proper execution of the early differentiation program and reducing the epidermal activation process which are essential for skin barrier [28]. At the same time, linolenic acid, eicosanoic acid, tetradecanoic acid, etc also can be detected in PURO. For the formation of the epidermal barrier, free fatty acids are essential for numerous processes. These compositions like seburm free fatty acids, linolenic acid, eicosanoic acid and tetradecanoic acid have good moisturizing and repairing the skin barrier function, can promote the synthesis of ceramide, moisturizing and nourishing effect, can regulate endocrine and anti-aging, between the skin and has the good affinity, good permeability, easily absorbed by skin, maintain skin nutrition and moisture and elasticity, improve skin corneum layer of degradation, repair rough skin [26,28-32]. Based on literature content, we consider that the components of PURO may be good for skin.

PURO Can Affect the Cell Migration in Hacat

Cell migration is an important process that effects many aspects of health, such as immune response, wound healing, tissue homeostasis and cancer [33,34]. In order to analyze whether the PURO can promote the cell migration, we use in vitro scratch assay on HaCAT cell line. We find that cell migrate faster in 5% PURO and 10% PURO treatment compared with blank treatment in 16 h and 24 h (Figure 2a-i). Then we use image J to calculate the healing area. The heal rate of 5% PURO treatment is 47.8%, 10% PURO treatment is 32.5% and the blank treatment is 16.6% in 16 h (Figure 2j). In 24h, the heal rate of 5% PURO treatment is

86.4%, 10% PURO treatment is 76.3% and the blank treatment is 63.2% (Figure 2j). These mean that the PURO can accelerate the cell migration and may have the function of wound healing and skin barrier.

 

Figure 2: In vitro scratch assay on HaCAT. Figure 2a: The HaCAT cell with PBS as blank on 0h; Figure 2b: The HaCAT cell with 5% PURO diluted by DMSO on 0h; Figure2c: The HaCAT cell with 10% PURO diluted by DMSO on 0h; Figure 2d, 2e, 2f: The HaCAT cell with PBS, 5% PURO and 10% PURO on 16h; Figure 2g, 2h, 2i: The HaCAT cell with PBS, 5% PURO and 10% PURO on 24h; Bar=100 μm. Figure 2j: The healing rate of PBS (blank), 5% PURO and 10% PURO on 16h and 24h.

Treatment Of PURO Reduced The Skin Penetration

As previous results show that PURO may accelerate healing and barrier in HaCAT cell line. We still need know whether PURO may have the function of skin barrier in reconstructed human epiderm model which recapitulating natural features in human skin. Firstly, we need to detect the skin irritation of PURO. The MTT assay suggest that the tissue activity of 10% PURO, 5%PURO formula and the Base are higher than 50%, which are similar to negative control (DPBS treatment) (Figure 3a). The relative expression of IL-1α release on 10% PURO, 5%PURO formula and the Base are similar to negative control (DPBS treatment) (Figure 3b). On the contrary, the relative expression of IL-1α release on positive control (SDS treatment) is up to 15fold (Figure 3b). That means PURO has no skin irritation to skin. Furthermore, we study the skin barrier protection effect of PURO through a skin penetration. Firstly, we use 0.2%SDS and 0.3%SDS to exposure on skin model for 10min and 20min, the tissue activity of 0.2%SDS-10min treatment and 0.2%SDS-20min treatment are higher than 80%; the tissue activity of 0.3%SDS-10min treatment is 60% which can be a damaged skin tissue, also maintains tissue activity (Figure S2a). Then we use 0.3%SDS to pretreat skin model for 10 min as the SDS damaged skin model. We find that the tissue activity of SDS damaged skin which exposure on 5% PURO formula is higher than 1% PURO formula. 1% PURO formula can not improve the tissue activity of SDS damaged skin (Figure S2b). The skin penetration of rhodamine B stain show that the permeability of rhodamine B (red) was reduced by exposure with PURO in the presence of SDS pretreated. Also, reduced in the absence of SDS pretreated (Figure 3c-f). These results suggest that PURO have no skin irritation and contribute to the barrier to Rhodamine B.

Treatment Of PURO Attenuated Irritant-Induced Cytotoxicity And Increase Time Of ET50

The protection of irritant-induced tissue death can be a way to determine the protective effects of skin barrier [35]. The 10% PURO formula was applied to EpiSkin^® which co-incubate with 0.2% SDS. Then, a barrier damage, 1% TritonX100 was treated at various time (5 min, 10 min, 20 min, 30 min). As a result, the ET50 of 10%PURO formula treatment is 20.734 min, Base treatment is 16.394 min (Figure 3g). The tissue activity of these PURO formula treatments showed that PURO significantly attenuated TritonX100-induced cell death than Base in EpiSkin® by MTT assay (Figure 3h). The longer the time, the better the barrier. That means PURO formula may remain the skin barrier of these tissues.

 

Figure 3: The skin penetration and irritant-induced cytotoxicity with PURO.

Figure 3a: The relative tissue activity of skin model with PURO formula treatment in MTT assay; Figure 3b : The relative expression of release of IL-1α with PURO formula treatment in skin model; Figure 3c and 3d: The Permeability of rhodamine B staining detected after 24h PURO formula and Base treatment of with SDS pretreatment; Figure 3e and 3f: The Permeability of rhodamine B staining evaluated after 24h PURO and Base treatment of with PBS pretreatment. The fluorescent images shown rhodamine B (red), DAPI staining (blue). The Bar= 50μm. Figure 3g: The ET50 data of 10% PURO formula and Base. Different treatment time has different tissue activity. The ET50 data calculate by SPSS. Figure 3h: The MTT assay of 10% PURO and Base with different treatment time.

Treatment Of PURO Increased The Expression Of Skin Barrier Genes On SDS Damaged Skin Model

Filaggrin and loricrin as the keratinized mantle protein have the function on skin barrier [3]. To further analyze the effects of PURO on epidermal differentiation, we detected the immunofluorescence with antibodies against filaggrin (FLG) and loricrin (LOR) on the treated tissues. We use 0.3%SDS to pretreat skin model for 10min as the SDS damaged skin model. Then the 10% PURO, 5% PURO formula and Base are treated on SDS damaged skin model. In the case of FLG, after 24h, there is intensity increase on 10% PURO, 5% PURO formula treatments, but no significant difference in the localization, (Figure 4a-c). In the case of LOR, immunofluorescence intensity increased on 10% PURO, 5% PURO formula treatments compared with Base treatment (Figure 4d-f). To confirm IF data (Figure 4) and investigate whether PURO can promote epidermal barrier repairmen indeed, mRNA levels of FLG and LOR were evaluated using QRT-PCR assay. PURO is topically applied to SDS damaged skin model for 24h and 48h. As a result, 10% PURO, 5% PURO formula treatments significantly increase the expression of FLG and LOR in 24h and 48h (Figure 5a and b). With the extension of incubate time, the expression of FLG and LOR that treated with PURO increase significantly (Figure 5a and b). As we all know, LOR, TJP1, CK10, DSG-1, involucrin (IVL) and CLDN5 are also involved in skin barrier [4,5,12]. The IF data show that the immunofluorescence intensity of CK10 significantly up-regulate after treated with PURO formula (Figure 6a-c). Furthermore, the QRT-PCR analyze shows that CK10, TJP1 and CLDN5 significantly up-regulate after treated with PURO formula (Figure 6d). Caspase-14, calpain 1, and bleomycin hydrolases can degrade filaggrin (FLG) protein into amino acids and amino acid metabolites in the stratum corneum. Those pivotal natural moisturizing factors are amino acids and amino acid metabolites, like rans-urocanic acid and Pyrrolidone Carboxylic Acid [8]. Bleomycin Hydrolase (BLMH) is a well-conserved cysteine protease that are extensively expressed in several mammalian tissues, especially on skin which contains high levels. BLMH take part in the degradation of citrullinated filaggrin monomers into free amino acids [7]. This is important to skin hydration. In atopic dermatitis (AD) patients, the expression and activity of BLMH is reduced [7]. Ceramides (CERs) are important for skin barrier function which belong to epidermal lipids. Deficiency of ceramide synthase 3 (CER3) results in lacking of continuous extracellular lipid lamellae and a non-functional cornified lipid envelope in mice [6]. Transglutaminases (TGMs) are membrane associated enzymes. TGMs have the function of imparting integrity to the stratum corneum by catalyzing e-(g-glutamyl) lysine crosslinking reactions [9]. The QRT-PCR show that involucrin (IVL), caspase-14 (CASP14), Bleomycin hydrolase (BLMH), ceramide synthase 3 (CER3) and Transglutaminases-1 (TGM-1) notably up-regulate in SDS damaged skin models, especially with 10% PURO formula (Figure 6e-g). We consider that high concentration of PURO could promote epidermal differentiation and skin barrier repairmen.