Journal of Tissue Culture and Bioengineering

The Peculiarities of Carbon Metabolism in the Ears of C3 Cereals, : The Carbon Metabolism and Key Genes Expression in The Photosyn-thetic Active Components of the Ear of Cereals

Nicolae Balaur1*, Dumitru Badicean1,2, Christoph Peterhaensel3, Per Gardestrom2, Lilia Mereniuc1, Veaceslav Vorontsov1, Dumitru Terteac1

1Institute of Genetics, Physiology and Plant Protection of Academy of Sciences of Republic of Moldova, Bioenergetics Laboratory, Republic of Moldova, Moldova

2Department of Plant Physiology, Umea University, Sweden

3Institute for Botany, Leibniz-University of Hannover, Germany

4Practical Scientific Institute of Horticulture and Food Technologies of Ministry of Agriculture and Food Industry, Chisinau, Republic of Moldova, Moldova

*Corresponding author: Nicolae Balaur, Institute of Genetics, Physiology and Plant Protection of Academy of Sciences of Republic of Moldova, Bioenergetics laboratory, Republic of Moldova. Tel: +37322556096; Email: bn1939@yahoo.com

Received Date: 09 January, 2018; Accepted Date: 16 February, 2018; Published Date: 26 February, 2018

Citation: Baluar N, Badicean DPeterhaensel CGardestrom P, Mereniuc L, et al. (2018) The Peculiarities of Carbon Metabolism in the Ears of C3 Cereals: The Carbon Metabolism and Key Genes Expression in The Photosynthetic Active Components of the Ear of Cereals. J Tissue Cult Bioeng: JTCB-102DOI: 10.29011/JTCB-102. 100002

1.      Abstract

The ear of C3 cereals makes an important contribution to yield formation, but the mechanisms ensuring this phenomenon are not completely elucidated. In this article was performed a comparative study of several key components that characterize the C3 and C4 carbon metabolism in the ear, flag leaf of cereals and in the tassel, leaf of maize plant. In the photosynthetic active components of the ear of cereals were registered higher activity of PEPC, compared to the flag leaf. However, isotopes discrimination did not show a difference between the ear and the flag leaf. The content of metabolites associated with photorespiration demonstrated higher Serine levels in the ear compared to the leaf. This peculiarity, on the background of high expression levels of RbcS and low expression of PEPC, assisted by relative high levels of Glycolate, Glycine and Glycerite, may indicate the existence of more active photorespiration cycle in the ear or the presence of glycine a pump, characteristic for the plants with C3 - C4 intermediate metabolism. Also, in the ear components was registered lower expression of GOX, compared to the flag leaf. The obtained results demonstrate a specific metabolism in the ear components of cereals, placing the ear in an intermediate zone, similar to C3 - C4 plants.

2.      Keywords: Carbon Isotopes Discrimination; Carbon Metabolism; Cereals Ear; Enzymes Activity; Gene Expression; Photorespiration; C3 Plants; C4 Plants.

1.      Abbreviations: 

Chl                        :               Chlorophyll

GC - MS                :               Gas Chromatography-Mass Spectrometry

GDC - H                :               Glycine Decarboxylase Subunit H

Gly                         :               Glycine

GOX                       :               Glycolate Oxidase

MDH                      :               Malate Dehydrogenase

NA                          :               Not available

NAD - ME              :               Malate Decarboxylase, NAD Dependent Malic Enzyme

NADP - ME            :               Malate Decarboxylase, NADP Dependent Malic Enzyme

PEPC                      :               Phosphoenolpyruvate Carboxylase

PPDK                     :               Pyruvate Orthophosphate Di Kinase

RbcL                      :               Rubisco Large Subunit

RbcS                      :               Rubisco Small Subunit

Rubisco                  :               Ribulose-1,5-bisphosphate carboxylase/oxygenase

Ser                          :               Serine

2.      Introduction 

Discovering the phenomenon of the lack of apparent photorespiration in the reproductive organs of the C3 cereals [1] revealed also the fact that in cereals only the leaf registers C3 photosynthesis. The rest of organs (ear, stem, leaf sheath, peduncle) have a CO2 exchange kinetics similar to the maize C4 leaf, also lacking apparent photorespiration [2]. These results suggested the assumption that cereal plants productivity is ensured by two mechanisms of carbon assimilation. One is of C3 type, localized in the in the leaves and the second one localized in the ear photosynthetic active components, that has some elements of the C4 photosynthesis that limits the CO2 losses in post-illumination phase [3].


From another part it is known that majority of enzymes necessary for C4 pathway are already present in C3 plants, but in lower quantities and it is supposed that C3 plants are preconditioned for C4 metabolism [4,5]. In the last decade appeared many works that demonstrate the C4 preconditioning assumption of the C3 plants.

In the cells surrounding vascular bundles in tobacco the radioactive signal from labeled malate was found in soluble sugars and amino acids, suggesting that CO2 originates from photosynthetic malate. It is considered that the genes involved in C4 photosynthesis were recruited from orthologs present in C3 species through modification of their spatial expression pattern and restriction to one cell type [6].

One of the main differences between C3 and C4 plants lies within the content and activity of PEPC. This is a specific C4 enzyme, active in cytosol of mesophyll cells, that fix CO2 in organic acids with four atoms of carbon: malate or aspartate. Nevertheless in the last decade several research teams reported about the presence and considerable activity of PEPC in C3 plants: in the cells surrounding vascular bundles in tobacco [4] and Arabidopsis [6], in the ear of Tr. aestivum L. [7], assuming its role in CO2 fixation. Plants with C4 photosynthesis have much more PEPC than Rubisco and need much less Rubisco in order to fix the same quantity of CO2 compared with C3 plants. This results in a greater efficiency of N utilization [8,9].

By mRNA-Seq 5 different species from Flaveria genus were compared (C3, C4 and C3-C4 types of photosynthesis) in order to quantify the transcriptome differences in the leaf. In the C4 Flaveria plants the biggest number of genes with reduced expression belonged to photorespiration group. Surprisingly was the fact that in C3-C4 intermediate species of Flaveria did not registered intermediate characteristics of genes expression levels: the expression level of photorespiration associated genes was even higher than in C3 species of Flaveria, but the expression levels of Calvin-Benson cycle genes was C3 similar [10]. Despite the fact that these species assimilate up to 50% of the carbon through C4 pathway.

From literature data it is known that C3 - C4 intermediate species of Flaveria do not register intermediate characteristics for photosynthesis and photorespiration genes expression compared to C3 and C4 species. Moreover, the abundance of the majority of the transcripts associated with the photosynthesis and the photorespiration were greater than in the C3 species, the expression of the majority of the genes of Calvin-Benson was C3 like with exception of RbcL, the expression level of which was significantly lower than in the C3 species [10].

Taking into account all mentioned above in this article was performed a comparative study of several key components that characterize the C3 and C4 metabolism: the PEPC activity; the relative contents of PEPC, RbcL and GDC-H; carbon isotopes discrimination; profiling of the main metabolites associated with photorespiration and the relative expression of RbcS, PEPC, GDC-H, GOX genes. All these investigations were performed for the flag leaf and ear components (glume, lemma and awn) in comparison to the maize leaf and tassel, in the same growing conditions and developmental stages.

3.      Materials and Methods

3.1.  Study Objects and Plant Growth Conditions 

C3 plants of Tr. durum L. (variety Hederiforme 335), Triticale (variety Ingen 93) and Zea mays (line 459 and hybrid RF7xW47) served as study objects. All these genotypes were grown in the experimental fields of the Institute of Genetics, Physiology and Plants Protection of the Academy of Science of Republic of Moldova and in the greenhouse of the Umea Plant Science Center (Sweden). Greenhouse conditions were: 20°C/15°C - day/night temperatures, 50%-70% relative humidity, 16h photoperiod with light intensity of 700 μmol/m2/s. Cereal plants were grown in pots of 3 liter, in two rows (3cm between rows) and fertilized with Rika-S (N-P-K, 7-1-8) through an automated irrigation system. At the stage of 2-3 leaves, plants were vernalized during one month: 15°C/5°C day/night temperatures, 50%-70% relative humidity and 8h photoperiod. After verbalization plants were returned back to the greenhouse. Maize plants (hybrid W47xRf7) were grown at the same greenhouse conditions, but in 10-liter pots. Biological material from maize (leaf and tassel glumes) were collected at the beginning of tassel flowering. In case of Tr. durum and Triticale biological samples were collected at two developmental stages (earning and milk/waxy (ripening) from four different tissues: flag leaf, awn, lemma and glume). All samples were collected in three biological repetitions and each repetition was composed by pooled material from three individual plants grown in different pots. Samples collection started after 6-8h of illumination, when photosynthesis reaches its maximum capacity. Samples were ground manually in liquid nitrogen, using a pestle and mortar, until a fine powder was obtained and stored in freezer at -80°C. The same stock of ground material was used for all the downstream experiments. The field grown plants were used for gas exchange analysis, anatomical structure and chloroplast ultrastructure determination. Plants from the greenhouse were used for enzyme activity assays, western blots, gene expression analysis and metabolite profiling.

3.2.  Chlorophyll CONTENT, PEPC Activity and Western Blot

Chlorophyll quantification was done using UV/VIS Lambda 18 Perkin-Elmer spectrophotometer at the three wavelengths:  646.6nm, 663.6nm, 750nm. All calculations were done according to [11]. Total proteins extraction and PEPC activity was done according to [12], monitoring photometrically (at 340nm) the oxidation of NADH through coupling the carboxylase reaction with MDH, at optimal temperature of 30°C, using HALO DB-30 UV-VIS (Dynamical) spectrophotometer. Protein extraction buffer contained 50mM HEPES-NaOH pH8, 10mM MgCl2, 5mM DTT, 1mM EDTA, 20% Glycerin, 1mM Pefabloc SC (Roche), 2% PVP. Reaction buffer contained 50mM HEPES-NaOH pH8, 5mM MgCl2, 5mM Glucose 6-phosphate, 1mM NaHCO3, 20% Glycerin, 0.2mM NADH, 6U/ml Malatdegydrogenase (MDH), pH8. In order to start the reaction to 850µl of reaction buffer was added 100µl protein extract and 50µl (2.5mM) PEP for positive reactions or water for controls. The activity of PEPC was calculated based on reaction rates recorded within a range where the increase in A340nm absorbance was linear. Protein concentrations were measured according to Bradford method using Bio-Rad kit in microplate assay and Spectra MAX 190 spectrophotometer. All isolated proteins were stored at -80ºC.

For Western blot the proteins were isolated from the same grinded material according to [13]. Protein extracts from different photosynthetic active components were resolved through SDS-PAGE [14] with different concentrations of acrylamide in order to ensure good protein separation. After electrophoresis proteins were electro-transferred on the nitrocellulose membrane [15]. For immunodetection polyclonal antibodies (Agrisera) were used in different dilutions: RbcL (1:5000), PEPC (1:500) si GDC-H (1:500). Coupled antibodies on membranes were detected through chemiluminescence using Amersham ECL Western blotting detection reagents and Fujifilm LAS-3000 Imager, according to manufacturer's recommendations.

3.3.  Total RNA Isolation and cDNA Synthesis

Total RNA was extracted from 20mg of grinded material using RiboZol (Ameresco) reagent, according to manufacturer's recommendations, in three biological repetitions. Isolated RNA concentration was checked at Nanodrop 2000 spectrophotometer and degradation level through gel electrophoresis (2% agarose, stained with Gel Red or Midori Green). After DNase treatment (DNA-free kit, Ambien) and RNA concentration re-measurement 1μg of total RNA was revers-transcribed using qScript cDNA Synthesis kit (Quanta), according to manufacturer's recommendations. Groups of five cDNA samples were pooled and used for negative RT reactions (reverse transcription without RT enzyme) - controls for DNA contamination in qPCR reactions. Isolated RNA samples were stored at -80ºC and cDNA samples at -20ºC.

3.4.  qPCR Analysis 

Samples processing and qPCR analysis were done according to MIQE guidelines [16]. Using NCBI database coding sequences of PEPC and Rubisco (small subunit) genes for Zea mays, Triticum sp. and coding sequences for GOX, GDC-H only for Triticum sp., (Table 1) were identified.

Primers where constructed using Primer3 software and synthesized commercially (Eurofins). The same primers were used for the analysis of Tr. durum and Triticale samples. The sequences of several potential reference genes were picked from the articles - 5 genes for maize and 3 for Tr. durum (Table 2), Triticale [17,18]. The experimental design was based on three biological repetitions and each biological repetition was processed in three technical repetitions. Amplification conditions were tested on a dilutions series of cDNA samples pool. PCR products were analyzed through 2% agarose gel electrophoresis in order to verify if only one fragment of expected size was amplified - crucial moments in qPCR.

For amplification we used EVA-Green kit (qPCR Eva Green qPCR Master mix (ABM)), half reactions and two step programs (40 de cycles: 94°C - 60sec, 60°C - 60sec) followed by melting curve analysis. Total volume of one reaction was 10µl and contained 1x EVA-Green reaction buffer, 10µM of each primer and 2µl of diluted cDNA (1:20). For standard curve we used a dilution series of pooled cDNA from each sample of the same genotype. All amplifications were run on Bio-Rad CFX70 machine and CFX Manager Software was used for data extraction. Obtained data were analyzed using the same method - determination of normalized relative expression level according to the formula:

RQ=(Eref^Cqref)/(Etarget^Cqtarget), [19]

Where:

E - efficiency of amplification reactions for reference and target genes;

Cq - cycle of quantification for reference and target genes.

Obtained relative quantities were log transformed in order to have them normal distributed and analyzed statistically using Excel.

3.5.  Reference Genes Screening

To screen potential reference genes Norm Finder software was used. Due to the little number of samples in case of maize samples, the reference gene was selected with CFX manager software during qPCR data analysis. The best gene combination was MEP and FPGS (Table 2). In case of Tr. durum and Triticale the genes with lowest expression stability levels (M) having respectively the most stable expression levels (Table 3) were selected.

3.6.  Metabolites Analysis with GC-MS 

Metabolites analysis was performed on the Metabolomics Platform at the Umea Plant Science Center (Sweden). Samples for metabolomics were prepared and processed according to [20] and for data analysis SIMCA software was used.

3.7.  Total Carbon Isotopes Discrimination 

For this analysis only the samples of maize leaf and Triticale flag leaf, ear components were selected. Approximately 1mg of grinded material was dried out at 70ºC for 18h and after that the relative abundance of 13C and 12C was determined using Isotope ratio mass spectrometer (Delta, Thermo Fisher Scientific) and Elemental analyzer (Flash EA 2000, Thermo Fisher Scientific). 

4.      Results and Discussion 

As mentioned previously the necessity to update research and discussions in the field of CO2 assimilation mechanisms and carbon metabolism in the ears of C3 cereals appeared as a consequence of the last results regarding the CO2 exchange in the ear [3]. Our results (CO2 exchange kinetics and compensation point, anatomical structure and chloroplasts ultrastructure in photosynthetic active components of the ear) demonstrated eloquently that in the ear of cereals (Tr. durum and Triticale) are present functional and structural elements of C3 and C4 types of photosynthesis. Based on these results were studied several key components of the carbon metabolism in the ear of cereals: the content and activity of key photosynthetic enzymes (Rubisco, PEPC, GDG-H); expression level of RbcL, PEPC, GDC-H and GOX; contend of the metabolites associated with photorespiration (glycolate, glycerite, serine and glycine).

4.1.  PEPC Activity in Photosynthetic Active Components of the Ear

One of the main differences between C3 and C4 plants lies within the content and activity of PEPC. This is a specific C4 enzyme, active in cytosol of mesophyll cells, that fix CO2 in organic acids with four atoms of carbon: malate or aspartate. Nevertheless in the last decade several research teams reported about the presence and considerable activity of PEPC in C3 plants: in the cells surrounding vascular bundles in tobacco [4] and Arabidopsis [6], in the ear of Tr. aestivum L. [7], assuming its role in CO2 fixation. Taking this into account the PEPC activity was determined in the flag leaf and ear components of C4 (maize) and C3 (Tr. durum, Triticale) plants. Obtained data were normalized against total chlorophyll content for each sample (Figure 1). PEPC activity in Tr. durum and Triticale was determined for earning phase and ripening phase, but for maize samples - beginning of tassel flowering. Recorded PEPC activity for maize (C4), Tr. durum and Triticale (C3) corresponds to data known in the literature [12]: PEPC activity in C4 plant is 10-20 times higher than in C3. For cereals ear components obtained values were greater than those for the flag leaf, with exception of awn, earning phase, were PEPC activity was similar to the flag leaf (Figure 2). In general, for earning phase, obtained values were greater compared to ripening phase. Maximum levels of PEPC activity was registered for Triticale lemma and for the glume, 2,04 and 1,4µmol/min/mg Chl respectively.

Similar results were obtained for Tr. Aestivum L., where for dough-development stage of the awn was registered PEPC activities (1.7 µmol mg-1 protein min-1) double higher than in the flag leaf [7]. Taking into account the high demand in carbohydrates and proteins for grain formation the authors concluded that PEPC in the ear is actively involved in the CO2 fixation in the light and CO2 respired in the dark or light. The presence of awns plays an important role in CO2 assimilation because they increase considerable the photosynthetic active area of the ear. Also the high thermo-tolerance and drought resistance of the ear is explained through more abundant presence and activity of PEPC comparing to the flag leaf [21]. Despite the suggestions of other authors, we registered higher PEPC activity in the ear components comparing to the flag leaf. 

4.2.  Western blot of PEPC, RbcL and GDC-H Proteins 

In order to estimate the relative amount of some key enzymes in photosynthesis and photorespiration Western blot was performed using polyclonal antibodies (Agrisera, SE). It is known that Rubisco content in C3 plants is much higher than in C4 plants [9]. Our hypothesis was that in the ear components, lacking apparent photorespiration, there should exist a mechanism of CO2 re-fixation that may result in lower amount of Rubisco. Obtained data partially confirmed that hypothesis. In Tr. durum and Triticale samples the most abundant protein was RbcL in both developmental stages, as expected for a C3 plant (Figure 3). Nevertheless, for the flag leaf the amount of detected protein was much higher compared with the ear components. For the maize leaf (C4) this protein was less abundant comparing to the rest of samples. 

Next detected protein was PEPC and its content in maize leaf was very abundant compared with RbcL, as expected for the C4 plant. In case of Tr. durum and Triticale lower quantities of PEPC were detected, besides the fact that on the gel 100 µg total protein was loaded. The greatest band intensities for both types of cereals were obtained for the flag leaf and awn (Figure 3 A, B). One possible explanation may be due to the usage of the polyclonal antibody for maize PEPC, on the other hand it is possible to say that this protein is present and active in the ear components of C3 cereals, especially in the awn. This fact confirms that PEPC enzyme with potential carboxylation function is present in C3 plants, but in much lower concentration compared to C4 plants (Figure 2 A, B).  The last protein that we detected was H protein of glycine-decarboxylase complex (GDC-H). Protein H plays a crucial role for the activity of entire GDC complex in mitochondria [22] and may be used as an indirect indicator of photorespiration.

4.3.  Carbon Isotope Discrimination in Triticale Ear Components 

Carbon isotopes 13CO2 and 12CO2 diffuse differentially through the leaf and because of Rubisco preferences for 12CO2 plants with different type of carbon metabolism (C3, C4, C3-C4 and CAM) have a specific signature after isotopes discrimination [23]. In order to determine the specificity of CO2 fixation metabolism in ear components total carbon isotopes discrimination was performed. We selected maize leaf as a C4 control and Triticale flag leaf as a C3 control. Clear differences were obtained for isotopes signature in maize leaf, that had less negative values compared to Triticale samples. For Triticale no difference was between the flag leaf and ear components (Table 4). Similar results were obtained for Flaveria species with intermediate type of metabolism (C3 - C4), where no difference was registered in carbon isotopes discrimination compared with C3 flag leaf of Flaveria [10], despite the fact that intermediate Flaveria species fix up to 50% of carbon through C4 pathway. Theoretically, lack of C4 signature in the ear components does not necessarily mean complete absence of C4 metabolism in respective photosynthetic tissues, taking into account also higher PEPC activity compared with the leaf (Figure 2). 

4.4.  Relative expression level of some photosynthetic and photorepiratoric genes (RbcS, PEPC, GDC-H, GOX) 

The majority of enzymes necessary for C4 pathway are already present in C3 plants, but in lower quantities and it is supposed that C3 plants are preconditioned for C4 metabolism [3]. In the cells surrounding vascular bundles in tobacco the radioactive signal from labeled malate was found in soluble sugars and amino acids, suggesting that CO2 originates from photosynthetic malate [6].

It is considered that the genes involved in C4 photosynthesis were recruited from orthologs present in C3 species through modification of their spatial expression pattern and restriction to one cell type [5]. 

In order to detect differences and similarities in CO2 assimilation metabolism between ear components of C3 cereals and maize leaf (C4) we determined the relative expression levels of several key genes in C3 and C4 photosynthesis (Table 1). Relative expression data were normalized against a reference gene, individually detected for maize and cereals, using several candidate genes and Norm Finder software (Table 2, 3). 

In case of maize leaf and tassel the expression level of PEPC and RbcS was determined. In the leaf PEPC expression was 5.6-fold higher than RbcS (Figure 4). Plants with C4 photosynthesis have much more PEPC than Rubisco and need much less Rubisco in order to fix the same quantity of CO2 compared with C3 plants. This results in a greater efficiency of N utilization [8,9]. In maize tassel the expression level of both genes was approximately at same level, but much lower compared with the leaf. For example, PEPC expression in the leaf was 4.9-fold higher than in the tassel. Although glumes of maize tassel are photosynthetic active and their chlorophyll content is very low (Figure 1). Relative gene expression data correspond to Western blot data for these proteins in maize, although in case of the proteins RbcL instead of RbcS was determined (Figure 3). 

For Tr. durum and Triticale, the relative expression of four genes was analyzed: RbcS, PEPC, GDC-H and GOX (Table 1). We chose these genes in order to characterize photosynthesis and the activity of photorespiratory cycle in the flag leaf and ear components.

For the ear components we obtained specific expression profiles for these genes. According to the data known in the literature the ear of Tr. aestivum has anatomical, ultrastructure and physiological advantages for CO2 fixation compared with the flag leaf. These advantages are more evident especially at the ripening stages. Increased stomata number and PEPC activity demonstrates that the ear has a superior capacity to adapt to different ecological conditions [24]. From another part, different ear components have a specific role in photosynthesis or protection of the grain. Microarray analysis of oat ear components revealed that lemma and paleo express more defense related genes, but in the awn more genes associated with photosynthesis are expressed [25]. These data suggest that lemma and paleo have defense/protection functions, but awn has photosynthetic function.

In our experiments for Tr. durum the maximum expression levels were for RbcS and minimum for PEPC. Differences were 23-63 folds, depending on the sample (Figure 5).

For RbcS in the earning phase the relative expression was higher in the flag leaf comparative to the ear components, but at the ripening phase, for all the samples, the expression was approximately at the same level. The situation is different for PEPC - for majority of samples in both phases the expression level is equal or lower compared with the flag leaf. Greater expression than in the flag leaf was detected only for awn at the ripening phase (1,13 fold). Taking into account the fact that in C3 plants many PEPC isoforms with other functions (housekeeping functions) are active than those of CO2 fixation and that the designed primers may be complementary to many of them it is hard to conclude about the expression level of this gene in Tr. durum ear components.

For the expression of GDC-H and GOX genes in Tr. durum we registered intermediate values compared with RbcS and PEPC. In the leaf the GDC-H expression was greater than in the ear components for both phases, with only exception for the glume at the ripening phase (1,3-fold higher expressions than in the leaf). This means that photorespiratoric cycle is present and active at the considerable level but less active in the ear components than in the flag leaf (Figure 5). Protein H of GDC complex is not involved directly in decarboxylation of glycine but acts as a scaffold for the rest of the three subunits (P, T and L) and it was demonstrated that the increased activity of this protein increases the activity of entire GDC complex [22]. Elevated CO2 flux through photorespiration cycle leads to the increased photosynthesis rates and 30% higher biomass accumulation. These results were obtained after overexpression of GDC-H from Flaveria pringley (C3) in Arabidopsis [26]. The positive effect was explained through photosynthesis blocked by photorespiration metabolites and their catabolism increase reduces this block. Glycolate oxidase (GOX) is one of the key enzymes of photorespiration cycle, it is active in peroxisomes where oxidation of glycolate to glyoxylate occurs. In order to characterize how much active, the photorespiration cycle in ear components and in the flag leaf is - we determined the relative expression of this gene. Obtained data revealed that in all the ear components expression level of GOX was lower than in the flag leaf. During the earning phase in awn, lemma and glume it was 3, 8 and 5-fold lower than in the flag leaf, but at the ripening phase its expression level was 2, 3 and 2-fold lower respectively (Figure 5). 

For Triticale samples the expression profile of analyzed genes in general is similar to Tr. durum, but there are several peculiarities. The maximum expression level was detected for RbcS but the lowest one for GOX or PEPC, depending on the sample. Registered differences between RbcS and PEPC were greater than those for Tr. durum: 600-1700-fold, depending on the sample (Figure 6). Greater PEPC expression than in the flag leaf was registered only for the glume at the earning phase (1,1 fold) and for awn at the ripening phase (1,4 fold). Similar to Tr. durum samples the RbcS expression level was greater in the flag leaf compared with the ear components with the exception of awn at the ripening phase (1,1-fold higher expression level than in the flag leaf, Figure 6).

Although differences in RbcS relative expression are not so great between samples, at protein level the differences are clearer: in the flag leaf there is more Rubisco than in ear components (Figure 3 A). For GDC-H gene lower expression levels than in the leaf were obtained for lemma and glume, earning phase (2,2 and 1,6-fold respectively). For awn at the earning phase and all ear components at the ripening phase the expression level of this gene was 1,4-1,6 fold higher than in the flag leaf. Greater expression of GDC-H may be associated with the presence of a glycine shuttle, that favor re-fixation of photorespiratoric CO2. Recently the existence of a CO2 concentration mechanism was proved, but previously it was only supposed to be present in the intermediate C3-C4 plants and it is considered to act as an intermediate step in the evolution of C4 photosynthesis [10]. In Flaveria, C3-C4 intermediate plants, the genes associated with photorespiration were induced at higher levels even than in C3 species and levels of glycine and serine (transport metabolites in CO2 pump) were higher than in C3 and C4 species of Flaveria. Authors concluded that there exist three CO2 fixation pathways acting in parallel in intermediate Flaveria species: NADP-ME, NAD-ME and glycine transport from mesophyll cells (where it cannot be de-carboxylate) into the cells surrounding vascular bundles. Here glycine is de-carboxylated and released CO2 is re-fixed by Rubisco, all process acts as a CO2 pump [10]. 

In case of GOX gene in all ear components the expression was lower compared to the flag leaf. Unlike Tr. durum in Triticale lemma and glume the expression of this gene was even lower than the PEPC expression (Figure 6). From literature data it is known that C3 - C4 intermediate species of Flaveria do not register intermediate characteristics for photosynthesis and photorespiration genes expression compared to C3 and C4 species. Moreover, the abundance of the majority of the transcripts associated with the photosynthesis and the photorespiration were greater than in the C3 species, the expression of the majority of the genes of Calvin-Benson was C3 like with exception of RbcL, the expression level of which was significantly lower than in the C3 species [10]. 

4.5.  Metabolites Analysis Through GC-MS 

In order to study the metabolite profile in the samples of C3 and C4 plants, especially the relative content of photorespiration associated metabolites, we performed the GC-MS analysis. 82 different metabolites were identified in the studied samples, derived from flag leaf and ear components of the greenhouse grown Triticale, Tr. durum and maize plants. In our investigations we focused on four main metabolites know to be associated with the photorespiration:  glycolate, glycerite, glycine and serine. Glycolate is formed as a result of the photorespiration at the chloroplast level, is transported to the peroxisomes and metabolized to Glycine.  Glycine is shuttled back to mitochondria and metabolized to Serine that is shifted back to peroxisome and metabolized to Glycerite. The last one is transported to the chloroplast and fuels the Calvin Cycle.

The values presented in charts in Figures 7-8 are relative, based on the relative and untargeted GS-MS quantification.  In the first experiment we analyzed samples derived from greenhouse grown maize, Triticale and Tr. durum plants at the atmospheric CO2 concentrations. We used the common stock of grinded samples for metabolites analyses.

For Tr. durum and Triticale samples the greatest amount of Glycolate was registered for the flag leaf compared with the ear components (Figure 7 A). Only in case of Tr. durum its relative amount was at the same level in the flag leaf and awn. The same trend was registered in case of the maize samples - approximately the same amount of glycolate in the leaf and in the tassel samples (Figure 7 E).

Glycine is the first amino acid that accumulates when the photorespiration cycle is active [23]. For triticale Triticale ear samples its content was higher compared with the flag leaf. The same is true for the maize samples - more glycine in the tassel compared with the leaf (Figure 7 F). In case of Tr. durum samples, the situation is different: in the ear components the content of Glycine is equal or lower than in the flag leaf (Figure 7 B). Interesting results were obtained for Serine. This amino acid is one the final products of photorespiration cycle obtained after decarboxylation of glycine in mitochondria by GDC complex. The content of serine in the ear components of Tr. durum and Triticale, with exception of lemma for Tr. durum, is greater than in the flag leaf (Figure 7 D). The same situation was registered for the maize samples - more serine in the tassel compared with the leaf (Figure 16 G). Glycerite, the last metabolite of photorespiration cycle, in the cereals samples was at the same level or more abundant in ear components than in the flag leaf (Figure 7 D). In case of maize samples, it was more abundant in the leaf, compared with the tassel (Figure 7 H). 

Taking into account the greater relative amount of Glycine, Serine and Glycerite in some of the ear components compared to the flag leaf it is possible to suppose the presence of a Glycine pump, similar to C3 - C4 intermediate species. This phenomenon may be explained through the presence of a glycine pump similar to C3 - C4 intermediate species of Flaveria, where glycine from mesophyll cells is transported to the cells surrounding vascular bundles and is de-carboxylated there [10]. This mechanism of CO2 concentration is considered as the first step in C4 evolution [27,28]. In our second experiment we decided to analyze the same four metabolites but in low/high CO2 atmosphere where photorespiration was induced or suppressed.  For that purpose, from greenhouse grown Triticale plants, we cut the ears at ripening phase (bellow the flag leaf) and placed in a glass with water in a special adapted chamber, where the CO2 content is maintained at a certain level.

Almost no differences were registered for Glycolate relative content, for analyzed flag leaf and ear samples in low and high CO2 (Figure 8 A). In high CO2 (suppressed photorespiration) Glycine was more abundant in flag leaf comparing to the ear components. In low CO2 atmosphere (induced photorespiration) the relative amount of Glycine was greater for each sample, than in high CO2, but however, the same trend was maintained- more Glycine in the flag leaf than in the ear components (Figure 8 B). Based on these data it is possible to conclude that photorespiratory cycle is present in the cereals ear components but is less active comparing to the flag leaf. 

In case of Serine we registered higher amounts in glume and much lower in the rest of samples for low and high CO2. For Glycerite we registered the same tendencies as for Glycine: more abundant in low CO2 conditions for the flag leaf comparative to the ear (Figure 8). 

5.      Conclusion 

1.       The active components of the ear registered increased levels of PEPC activity, with maximum values for glume and lemma. Determination of the relative amount of several key enzymes for photosynthesis and photorespiration (PEPC, RbcL, GDC-H) revealed and abundant level of RbcL in the flag leaf of cereals and of the PEPC in maize leaf. In the ear components were registered traces of PEPC and the amount of RbcL was lower compared to the flag leaf. In the maize leaf was not registered the presence of GDC-H, but these proteins were abundant in the flag leaf of cereals and in lower quantities in the ear components;

2.       Carbon isotopes discrimination registered a clear difference between the maize leaf and cereals ear, leaf. The ear components had the same signature as the flag leaf of cereals.

3.       GC-MS analysis of the metabolites associated with photorespiration (glycolate, glycerite, glycine and serine) revealed a higher content of serine in the ear components compared to the flag leaf. The same peculiarity was registered for glycine, but only for the ear of Triticale. Similar profile of serine and glycine was registered for the maize C4 leaf and in the tassel the content of these metabolites was higher compared to the leaf;

4.       Determination of the relative expression level of RbcS, PEPC, GDC-H and GOX evidenced peculiarities for the photosynthetic active ear components. The most abundant expression was registered for RbcS and minimum for PEPC. The RbcS was more intense expressed in the flag leaf at earning phase of cereals, but in the waxy-milk phase its expression level was similar in the leaf and ear components. For PEPC higher expression was detected in awn, ripening phase. For the rest of ear components its expression level was lower comparing to the flag leaf. The GDC-H gene had more or less similar expression levels in the ear components and flag leaf in Tr. Ddurum, but for Triticale the highest expression level was detected for the awn. The highest GOX gene expression was detected in the flag leaf and lower levels of expression for the ear components. 

6.      General Conclusion

The obtained results demonstrate that the ear of cereals, covering 10-70% from all plant photosynthesis, cannot be considered as an organ with only C3 type of photosynthesis. There are present also structural and functional elements of C4 photosynthesis, that may ensure the re-fixation of the CO2 released from respiration and photorespiration. 

As a proof is the lack of apparent photorespiration, but also the presence of an active photorespiration cycle. This complex mechanism that combines elements of C3 and C4 photosynthesis, with different expression levels, place the ear in an intermediate zone, similar to C3 - C4 plants. The lack of apparent photorespiration and the concomitant presence of the photorespiration cycle in the ear may serve as pomp that ensure with CO2 the pentose phosphate cycle and increase the efficiency of photosynthesis. 

It is possible to suppose that during the evolution of C4 plants this pomp was substituted by the C4 cycle, where the CO2 fixation is performed in the mesophyll cells by PEPC, an enzyme with only carboxylation capacity, different from Rubisco. These peculiarities may open new opportunities for biotechnological use of evidences mechanisms in order to increase the photosynthesis efficiency and productivity of cereals. 

7.      Funding

This work was supported by Institutional Project 11.817.04.04F, financed by Academy of Science of Republic of Moldova and grant nr. 5386 from Science and Technology Center in Ukraine; also, partially by Visbi Postdoctoral fellowship to DB.


Figure 1: Chlorophyll content in maize (C4) and Tr. durum, Triticale (C3) samples harvested at the two developmental stages. The average of 3 biological repetitions ± 95% confidence interval is presented.



Figure 2: Activity of PEPC in Tr. durum, Triticale at two developmental stages and maize samples. The average of 3 biological repetitions ± 95% confidence interval is presented.



Figure 3: Western-blot analysis of PEPC, RbcL and GDC-H proteins in maize, Triticale (A) and Tr. durum (B) samples. In case of the RbcL detection, for maize samples, 30µg total protein was loaded and for cereal samples - 4 µg; in case of PEPC for maize samples 30µg total protein was loaded and for cereal samples - 100 µg; in case of GDC-H detection for all samples 30µg total protein was loaded. The gels were resolved on SDS-PAGE (8% for RbcL, PEPC and 18% for GDC-H), transferred on nitrocellulose membrane and probed with polyclonal antibodies. The membranes were developed using ECL standard reagent.



Figure 4: Normalized relative expression level of PEPC and Rubisco genes in maize samples (tassel and leaf) collected at the tassel flowering stage, in log2 scale. The average of 3 biological repetitions ± 95% confidence interval is presented.



Figure 5: Normalized relative expression level of Rubisco, PEPC, GDC-H and GOX genes in Tr. durum samples, in log2 scale. The samples were collected from different photosynthetic active tissues at 2 different developmental phases (earning and ripening). The average of 3 biological repetitions ± 95% confidence interval is presented.



Figure 6: Normalized relative expression level of Rubisco, PEPC, GDC-H and GOX genes in Triticale samples, in log scale. The samples were collected from different photosynthetic active tissues at 2 different developmental phases (earning and ripening). Is presented the average of 3 biological repetitions ± 95% confidence interval.




Figures 7(A-H): Relative content of four main metabolites associated with photorespiration (glycolate, glycine, serine and glycerite) in C3 cereals (Triticale and Tr. durum) and maize (C4), determined through untargeted GS-MS analysis. The material was harvested from greenhouse grown plants at ripening phase. Is presented the average of 3 biological repetitions ± 95% confidence interval.



Figures 8(A-D): Relative content of four main metabolites associated with photorespiration (glycerite, glycolate, glycine and serine) in Triticale ears acclimated in low CO2 (150 ppm, 22ºC, 80% humidity) and high CO2 (2000 ppm, 22ºC, 80% humidity) chamber. The plants were grown in greenhouse conditions and harvested ears at ripening stage were placed in a glass with water, in special adapted chamber with low/high CO2 atmosphere. Metabolites analysis was performed through untargeted GS-MS analysis. The material was harvested from greenhouse grown plants at ripening phase. Is presented the average of 3 biological repetitions ± 95% confidence interval.

 

Gene

Primers sequence, 5’......3’

Amplicon

size, bp

PCR efficiency

Triticum RbcS mRNA, (2 Exons)

CGC GTC AGC AAT GGC GGA AG

143

Tr.durum/Triticale

1.85/1.82

GTC GAC CTG CTT CAG GAG GG

Triticum PEPC mRNA (2 Exons)

GGA GAC CCA GAA GCT GCT TC

213

2.00/2.07

GAT CCT CTT CAA TGT GTA TGC CTG

Maize Rubisco small subunit (RbcS)

GGTGTACAAGGAGCTGCAGGAGGCCAT

173

1.85

GGCAGAGGCATGGCCATGGGTCG

Maize PEPC

AGAACTCAAGCCCTTTGGGAAGC

238

1.82

GTCGGCGAACTCCTTGGACAGC

Triticum GDC-H

CACGAGTGGGTCAAGAACGA

155

1.88/1.92

GCCTTCACACTCTCCACGTT

Triticum GOX1

TGTATCGGAGTACCAGGCCA

120

1.89/1.85

ATCCTGGAGAATGCCTCCCT

 

Table 1: The sequence of used primers, amplicon size and reaction efficiencies for the detection of RbcS, PEPC, GDC-H and GOX1.

 

Gene

Gene annotation/ gene product

Primers sequence, 5’......3’

Amplicon size, bp

qPCR efficiency calculated from slope

Tr. durum/Triticale

Ta2291

ADP-ribosylation factor

GCTCTCCAACAACATTGCCAAC GCTTCTGCCTGTCACATACGC

165

1.99

Ta54227

Cell div. control prot. (AAA-superfam. ATPases)

CGATTCAGAGCAGCGTATTGTTG

AGTTGGTCGGGTCTCTTCTAAATG

227

NA

Ta2776

Similar to RNase L inhibitor-like protein

CAAATACGCCATCAGGGAGAACATC

CGCTGCCGAAACCACGAGAC

242

1.94

Zea mays

CUL

Cullin

CAGGTGGGGTATTCTTGGTG

ATGTTCGGGTGGAAAACCTT

274

NA

FPGS

Folylpolyglutamate synthase

ATCTCGTTGGGGATGTCTTG

AGCACCGTTCAAATGTCTCC

132

1.86

UBCP

Ubiquitin carrier protein

TCCAGTGCTACAGGGAAGGT

GTTAGTTCTTGAGCCCACGC

231

NA

MEP

Membrane protein PB1A10.07c

GAAGAGCCGCAAAGTTATGG

ATGGTAGAAGTGGACGCACC

203

1.97

LUG

Leunig

TGTACTCGGCAATGCTCTTG

TTTGATGCTCCAGGCTTACC

178

NA

 

Table 2: Primers sequences for reference genes, amplicon size and reaction efficiencies.

 

Reference gene

Expression stability level (M)

Tr. durum

Triticale

Ta2291

0,136

0,267

Ta54227

0,215

0,264

Ta2776

0,211

0,174

 

Table 3: Expression stability levels of candidate reference genes for maize, Tr. durum and Triticale.

  1. Balaur NS (2007) Photorespiration absence phenomenon in the reproductive organs of C3 plants. Bul Acad Sci Mold Life Sci 2: 166-167.
  2. Coombs DOHJ, S.P.L. and Scurlock JMO, eds, TECHNIQUES IN BIOPRODUCTIVITY AND PHOTOSYNTHESIS, 2nd Editio, PERGAMON PRESS, 1985.
  3. Balaur NS, Vorontsov VA, Merenyuk LF (2013) Specific features of photorespiration in photosynthetically active organs of C3 plants. Russian Journal of Plant Physiology 60: 184-192.
  4. Hibberd JM, Quick WP (2002) Characteristics of C4 photosynthesis in stems and petioles of C3 flowering plants. Nature 415: 451-454.
  5. Brown NJ, Newell CA, Stanley S, Chen JE, Perrin AJ, et al. (2011) Independent and parallel recruitment of preexisting mechanisms underlying C₄ photosynthesis. Science 331: 1436-1439.
  6. Brown NJ, Palmer BG, Stanley S, Hajaji H, Janacek SH, et al. (2010) C4 acid decarboxylases required for C photosynthesis are active in the mid-vein of the C species Arabidopsis thaliana and are important in sugar and amino acid metabolism. Plant J 61: 122-133.
  7. Li X, Wang H, Li H, Zhang L, Teng N, et al. (2006) Awns play a dominant role in carbohydrate production during the grain-filling stages in wheat (Triticum aestivum). Physiol Plant 127: 701-709.
  8. Osborne CP, Freckleton RP (2009) Ecological selection pressures for C4 photosynthesis in the grasses. Proc Biol Sci 276 :1753-1760.
  9. Ghannoum O, Agepati S, Raghavendra Rowan F, Sage, (2011) C4 Photosynthesis and Related CO2 Concentrating Mechanisms. 129: 146.
  10. Gowik U, Bräutigam A, Weber KL, Weber APM, Westhoff P (2011) Evolution of C4 photosynthesis in the genus Flaveria: how many and which genes does it take to make C4. Plant Cell 23: 2087-2105.
  11. KPE, Porra RJ, Thompson WA (1989) Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochim Biophys Acta 975: 384-394.
  12. Ashton A, Burnell J, Furbank R, Jenkins C, Hatch M (1990) The enzymes in C4 photosynthesis. Photosynth Res 26: 161-170.
  13. Sudderth EA, Muhaidat RM, McKown AD, Kocacinar F, Sage RF (2007) Leaf anatomy, gas exchange and photosynthetic enzyme activity in Flaveria kochiana. Funct Plant Biol 34: 118-129.
  14. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685.
  15. Burnette WN (1981) “Western blotting”: electrophoretic transfer of proteins from sodium dodecyl sulfate--polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal Biochem 112: 195-203.
  16. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, et al (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55: 611-622.
  17. Manoli A, Sturaro A, Trevisan S, Quaggiotti S, Nonis A (2012) Evaluation of candidate reference genes for qPCR in maize. J Plant Physiol 169: 807-815.
  18. Paolacci AR, Tanzarella OA, Porceddu E, Ciaffi M (2009) Identification and validation of reference genes for quantitative RT-PCR normalization in wheat. BMC Mol Biol 10: 11.
  19. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, et al. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3: 34.
  20. Lee DY, Fiehn O (2008) High quality metabolomic data for Chlamydomonas reinhardtii. Plant Methods 4:7.
  21. Xu XL, Zhang YH, Wang ZM (2003) Effect of heat stress during grain filling on phosphoenolpyruvate carboxylase and ribulose-1,5-bisphosphate carboxylase/oxygenase activities of various green organs in winter wheat. Photosynthetic 42: 317-320.
  22. Bauwe H, Kolukisaoglu U (2003) Genetic manipulation of glycine decarboxylation. J Exp Bot 54 :1523-1535
  23. Troughton JH, Card KA, C.H. H (1974) Photosynthetic pathways and carbon isotope discrimination by plants, Carnegie Institute of Washington Year Book.
  24. Kong L, Wang F, Feng B, Li S, Si J, Zhang B (2010) The structural and photosynthetic characteristics of the exposed peduncle of wheat (Triticum aestivum L.): an important photosynthate source for grain-filling. BMC Plant Biol 10: 141.
  25. Abebe T, Wise RP, Skadsen RW (2009) Comparative Transcriptional Profiling Established the Awn as the Major Photosynthetic Organ of the Barley Spike While the Lemma and the Palea Primarily Protect the Seed. Plant Genome 2: 247-259.
  26. Timm S, Florian A, Arrivault S, Stitt M, Fernie AR, et al. (2012) Glycine decarboxylase controls photosynthesis and plant growth. FEBS Lett 586: 3692-3707.
  27. Sage RF, Christin PA, Edwards EJ (2011) The C (4) plant lineages of planet Earth. J Exp Bot 62: 3155-3169.
  28. Fernie AR, Bauwe H, Eisenhut M, Florian A, Hanson DT, et al (2012) Perspectives on plant photorespiratory metabolism. Plant Biol (Stuttg) 1: 6.

© by the Authors & Gavin Publishers. This is an Open Access Journal Article Published Under Attribution-Share Alike CC BY-SA: Creative Commons Attribution-Share Alike 4.0 International License. Read More About Open Access Policy.