Development and Clinical Application of Liquid chip Luminex Assay in theDetection of Epidermal Growth Factor Receptor and K-Ras Mutation
Yan Zhou1*, Yangyang Xu2, Xiaoqian Wang2, Xiaohui Liang2, Jiatao Lou2
1Division of
Immunology, Department of Microbiology and Immunobiology, Harvard Medical
School,USA
2Department of Laboratory Medicine, Shanghai Chest Hospital of Shanghai Jiao,Tong University, Shanghai, China
*Corresponding author: Yan Zhou,
Division of Immunology, Department of Microbiology and Immunobiology, Harvard
Medical School, 77 Avenue
Louis Pasteur, Boston, MA 02115, USA. Tel: 617-229-9058; E-mail: Yan_Zhou@hms.harvard.edu
Received Date: 06 March, 2017; Accepted Date: 15 March, 2017;
Published Date: 22 March, 2017
Citation: Zhou Y, Xu Y, Wang X, Liang X, Lou J (2017) Development and Clinical Application of Liquid chip Luminex Assay in the Detection of Epidermal Growth Factor Receptor and K-Ras Mutation. J Vaccines Immunol 2017: 107. DOI: 10.29011/2575-789X.000107
Purpose: The
success of molecular targeted cancer therapy relies on the accurate detection
of the mutated gene. We attempted to develop a rapid, accurate, high sensitive
and specific liquid chip luminex method for the detection of EGFR and K-ras
mutation, both of which are an important biomarker for the personalized
treatment of advanced lung cancer patients.
Materials and
Methods: Using the liquid chip technology, we developed a luminex
system by combining PCR-LDR (Polymerase Chain Reaction-Ligase Detection Reaction)
with Luminex platform for the detection of EGFR and K-ras mutation. To verify
the clinical application of this liquid chip luminex system, we compared its detection
results with those from the gold standard sequencing method through analysis of
100 patients.
Results: The
developed luminex system showed high flux, sensitivity and specificity for EGFR
and K-ras gene mutation detection. Compared with sequencing for the EGFR and
K-ras gene mutation detection, this luminex system showed no obvious difference
in the mutation rates among different ages, histological classification and TNM stages. However, for the exon21 L585R and exon19 (including the E746-A750 deletion
mutant), the luminex method showed even more effective and specificity and
demonstrated obvious difference to sequencing (p<0.05).
1. Introduction
Lung cancer is one of the leading causes of mortality and
consists of Small-Cell Lung Cancer (SCLC) and non-small-cell lung cancer
(NSCLC) [1]. The conventional treatment includes combined chemotherapy,
radiotherapy and surgery. However, most patients become resistant to these
therapies at later time. Cancer cells depend on the gain-of-function mutation
of oncogenes and/or loss-of-function mutation of tumor suppressor genes
(oncogene addiction), leading to the current trend of molecular targeted cancer
therapy. Epidermal growth factor receptor (EGFR) is a member of ErbB receptor
tyrosine kinase family and frequently mutated in NSCLC cancers [2]. NSCLC
patients with somatic EGFR mutations (Table 1).
In exon 19, exons 20 or exon 21 are sensitive to tyrosine kinase
inhibitors(TKIs), including gefitinib and erlotinib [3]. In contrast, patients
with K-ras mutation in codons 12 and 13 are resistant to TKIs [4-6]. Therefore,
it is critical to accurately determine the mutation status of EGFR and K-ras
for the selection of patients who may benefit from TKI therapy [7]. Recently, direct
sequencing, allele-specific PCR, amplification-refractory mutation sequencing
(ARMS), H&E-staining, and quantitative real time PCR are available for
detection of gene mutation [2,5,8,9]. Nevertheless, these techniques are
relatively expensive, technically difficult, long procedure for routine
application in clinic, and also depend on the quality of the samples [10].
Moreover, due to the non-targeted detection, direct DNA sequencing has a limited
sensitivity for the detection of tumor cells containing an
EGFR exon 21 L858R mutation and 19against a background of non-mutant cells [1].
In this study, we developed a liquidchip luminex system by combining PCR-LDR
(Polymerase Chain Reaction- Ligase Detection Reaction) with Luminex platform
for the detection of EGFR and K-ras mutation. In comparison to the gold-standard
sequencing, liquidchip luminex system has similar sensitivity and specificity,
but simple operation, time and money saving. Our study suggests a promising
clinical application of liquid chip luminex system for detecting gene mutation
and helping physician to stratify patients for molecular targeted cancer therapies.
2. Methods and Materials
2.1. Patients
One hundred patients hospitalized in Shanghai Chest Hospital
from November 2011 to February 2012 were recruited in this study. All patients
received surgery or chemotherapy during these days. The diagnoses of all
patients were confirmed by radiographic inspection and pathological
examination. Patient’s demographics and characteristics were summarized in
(Table 2).
The median age was60 years (range 50-70). The male/female ratio
was 51/49. Among the 90 patients who we followed up, 30 patients are smokers
(33.3%), 16 were squamous cell carcinoma (17.8%), 63 were adenocarcinoma (70%),
and 11 were other chest tumors (12.2%). According to the UICC criterion, 24
patients were classified as stage I (26.7%), 22 patients as stage II (24.4%),
19 patients as stage III (21.1%) and 25stage IV (27.8%).
2.2. DNA extraction
Genomic DNA was extracted from formalin-fixed paraffin embedded
tissue composed of at least 50% tumor cells with D Neasy Blood& Tissue Kit
(Qiagen). In brief, 50mg samples were grinded with liquid nitrogen and digested
overnight by protease K at 50℃, followed by
precipitation with buffer AP and buffer W1. The precipitate was dehydrated
in ethanol, resolved in buffer TE and saved at -20℃. The concentration and purity of the extracted DNA were
assessed by spectrophotometry.
3. Construction of the reaction system
EGFR PCR amplifications were carried out in 20 µl reaction
mixtures containing 1.2µl 10×Buffer 2 µl, Mg2+(25
mmol/L) (or 0.6 µl for K-ras), 2 µl dNTPs (2.5 mmol/L),1 U Hot Sar Taq DNA
polymerase, 4 µl 5×Q-solution (or 0.5 µl for K-ras), primer premixture 4 pairs
with 2 µl 1µmol/L for each single one (2 pairs for K-ras), 2 µl genome DNA
template (4 µl for K-ras) (5~10 ng). PCR parameters, Denaturation at 95℃ 15 min, 35 rounds (36 for K-ras) of cycling, 94℃ 30 sec, and 55℃ (60℃ for K-ras), 30 sec, 72℃ 30 sec, followed by a
final elongation at 72℃ for 10 min
(5minutes or K-ras). EGFR LDR reaction consisted of two steps, pre-denaturation
and ligation cycling. 20 µl LDR reaction mixture was added into 20 µl PCR
products. A20 µl reaction system was composed of 2 µl 10×Ligase Buffer,
ligation probe pre-mixture 8 pairs, 4 µl 1 µmol/L for each single one (2 pairs
for K-ras), 16 U Taq Ligase. The reaction system was pre-heated at 95℃ for 5 min, then cycled for 20rounds at 94℃ (95℃ for K-ras) and
55℃ (62℃for K-ras) for 30
seconds consecutively.
4. Luminex array
Luminex microsphere hybridization system was composed of 22 µl
microsphere hybridization premixure where microspheres were wrapped up with
anti-TAG sequences and 3 µL LDR reaction products containing complementary TAG sequences
(Luminex). The hybridization mixture was incubated at 45℃ for 10minutes on PCR instrument. A second incubation was
performed in 75 µl SA-PE. Signal intensity was detected by Luminex 200.
5. PCR primers design
4 pairs of EGFR amplification primers were designed for 18, 19,
20, 21 exons in EGFR gene (NM_005228) using Primer Express 3
online design software (Table 3).
K-ras primers were designed for exon 2 in K-ras gene
(NM_033360.2) using the same software (Table 3). PCR primers were synthesized
by Shanghai Biological Engineering Company. 8 EGFR or K-ras mutation sites in
PCR products were detected by LDR. Upstream probe had a 24 bp TAG sequence in
5’ end and a 22-27 bp specific sequence in 3’end, whereas downstream probe held
a 20-24 bp specific sequence (Table 3). The 5’ and 3’ end of the downstream
probes were phosphorylated and biotinated, respectively.
6. DNA sequencing
Each hot-spot mutation site was amplified by single PCR,
followed by DNA sequencing to determine the consistency between PCR-LDR-Luminex
system and DNA sequencing in detecting EGFR and K-ras gene mutations. DNAs were
isolated from the gels, purified and sequenced directly by an ABI-Prism 377
sequencers. All100 patients were sequenced and detected for the mutation of
EGFR and K-ras by the PCR-LDR-Luminex system.
7. Methodological Evaluation
Cut-off signal intensity: it was defined positive when the
hybridization signal was over 200 ascertained with mean fluorescence intensity
(MFI), and meanwhile its ratio versus wild type DNA negative control signal was
bigger than 1. The repeatability assessment: we detected the 8 kinds of EGFR
and K-ras mutant types mixed with the negative wild type DNA (10000:10000 gene
copies) for 10times, and recorded the mean fluorescence intensity signal to get
the mean CV value. The consistency of the two detection
methods was calculated by the mutant number from luminex multiplied by that
from sequencing. Sensitivity: to evaluate the sensitivity of the established
assay, using the luminex system, we detected the EGFR gene mutant rates from
the EGFR mutants control and the wild type mix (the mutant: wild
type=2000:10000 copies). To show the sensitivity of our luminex system
comparing to the sequencing, we used the mutant numbers which can be detected
by luminex multiplied with the exact numbers from the sequencing. Specificity:
to access the specificity of the established assay, we separately detected the
positive mutant control mixed with the wild type DNA=10000:10000 (copies)and
the negative control for 3 times simultaneously. To show the specificity of our
luminex system among the 100 patients, comparing to the sequencing, we use the negative
numbers which detected by luminex times the mutant from the sequencing methods.
7.1. Statistical Analysis
The Graph Pad prism 5.0 software was used for statistical
analysis. The significance P values were analyzed using One-tailed, Fisher’s
exact test with 95% confidence interval.
8. Results
8.1. The performance assessment of liquid chip
Luminex assay for the detection of EGFR and K-ras mutation
Using our luminex assay, we found that EGFR gene rate was
between 10%-20%, where we only found 1% with DNA sequencing (Table S1), demonstrating
that luminex assay is more sensitive than direct DNA sequencing. The
specificity of the luminex system was confirmed by the perfect matching when
detecting the positive mutant control, wild type and the negative
control (Table S3). Repeatability assay demonstrated the mean CV was
4%~15% (Table S2).
8.2. EGFR mutation status analysis
using sequencing and luminex assay
We screened EGFR mutation in 100 samples by luminex assay and
sequencing. For the luminex assay, there were 39 mutants in the 97 patients
(40.2%) (3 patients failed due to the week signals). With sequencing, 51
mutants were found in the 100 patients (51%). Thus, there was no significant
difference between these methods in detecting the mutant rate of EGFR
(p>0.05). Among the EGFR mutants detected by luminex, 84.6% resulted from
exon 19: E746-A750 deletion (30.7%) and exon 21: L858R point mutation (53.8%).
While by sequencing, 72.5% of the EGFR mutations were due to E746-A750 deletion
(47.1%)and exon 21: L858R point mutation (25.5%)
These results indicated that luminex showed an advantage in
detecting the hot mutant sites, including the exon 19 and 21excluded the mixed
mutant patients (p<0.05). For exon 19 deletion, 17 patients were detected by
luminex (43.6%) in comparison to 24 (47.1%) by sequencing.
However, in the 24 patients detected by sequencing,14 were also found by
luminex. Thus, the two methods showed obvious difference(p<0.05) in
detecting exon 19: E746-A750del, 19: delL747-P753insS, 19: delL747-T751.
However, apart from the 19 delL747-P753 and delL747-T751, DNA sequencing also
detected these rare deletions, including one exon 19 L747-E749 del, one 19
L747-S752del, one 20 insertion mutation and one 21 V845L mutation, indicating
that luminex can easily detect the most common 15-bp deletion in exon 19of EGFR
and some but not all rare exon 19 deletions.
As to the exon 21 mutations, 22 and 26 patients were detected by
luminex and sequencing, respectively (2 exon 21 L858R mutant patients failed in
the luminex assay). The mutation rate was 56.4% by luminex, which is higher
than by sequencing (49%). Of the 22 patients detected by luminex, 21 were the
L858R (95.5%). 19 out of 26 patients (73%) detected by sequencing were excluded
from the 3 mixed mutant,2 failed patients and 2 other sites mutant. The two
methods showed obvious difference in the exon 21 L858R detection (p<0.05).
However, they both detected exon 21 L861Q (Table 4).
Moreover, the two methods showed no obvious difference in the
detecting exon 19and 21 in different age, sex, smoking, histological
classification, and clinical stages. For example, for >=60 or <60 ages
people, the two methods demonstrated no obvious difference in the detection of
the 21 L858R and 19: delE746-A750. In addition, for the people who smoke or not
(female/male, adenocarcinoma/squamous cell carcinoma, type I/II/III/IV clinical
stages), similar results were found (p>0.05) (Table 5).
These data demonstrated that the advantage of Luminex system is
in the detection of exon 19 E746-A750del and exon 21 L858R for EGFR.
8.3. Luminex assay is comparable to sequencing in the
detection of K-ras mutation
We additionally compared luminex assay with sequencing in
the detection of K-ras mutation and found both methods detected the 5 K-ras
mutation (3 Gly12Val GGT>GTT and 2 Gly12Asp GGT>GAT). The 5 K-ras
mutation included 4adenomatous carcinoma (AD) and 1 (SCC) among 1 woman and 4
man with 4Clinical IV stage and 1 Clinical III stage (Table 6).
These results demonstrated that luminex assay is comparable to
sequencing in the detection of K-ras mutation.
8.4. A total comparison of the two Luminex
and sequencing methods
The Luminex-based K-ras mutant detection assays showed 100%
agreement with sequencing. Except for 3 patient samples, which were not tested
by the
Luminex assay due to the limited DNA amount,75(79.4%) EGFR mutants detected by luminex were
overlapped with the results with sequencing, which detected 39 mutant and 36
wild types. In addition, set the sequencing as the gold standard, the
sensitivity of luminex assay is 97.5%, and the specificity of luminex assay is
89.6%. These data demonstrated the sensitivity and specificity of this
Luminex-based EGFR and K-ras mutant detection system is comparable to
sequencing. Comparison of other factors between the two methods was summarized
in the (Table 7).
The major differences are times-cost, money-cost and person
requirement. For example, the luminex needs 20ng DNA, while sequencing requires
50 µg DNA. These findings suggest a feasible application of
luminex assay for detection of gene mutants in the clinic.
9. Discussion
EGFR is a member of the ErbB family, which also includes HER2,
HER3, andHER4. Activating mutations in the tyrosine kinase domain play an
important role in lung oncogenesis, tumor progression, and clinical efficacy of
efitinib or erlotinib. Thus accurate detection of EGFR mutations will determine
the success of targeted therapy for lung cancer. In the past decade, many
efforts have been made to develop a more specific and sensitive methodology for
gene mutation detection. While most if not all, the established techniques have
problems for routine usage in clinical laboratories. Many of these limitations
may overcome by particle-based flow cytometric assays, which combined PCR-LDR
(Polymerase Chain Reaction- Ligase Detection Reaction) with Luminex platform
for the simultaneous detection of 8 kinds of high frequency EGFR and K-ras gene
mutations. First, 8 specific segments containing hot-spot mutation sites in
EGFR gene, codon 12 and 13 of K-ras gene were amplified, respectively.
Multiplex LDR reaction was performed consequently toligate
upstream and downstream probes whose products carried TAG sequence at 5’end of
the upstream probe and biotin at the downstream probe. Luminex reaction system
contained 9 coding microspheres, all of which were wrapped up respectively with
specific anti-TAG sequences in order to capture correspondent EGFR and K-ras mutation
PCR-LDR products.
Once upstream and downstream probes were ligated,
PCR-LDR products hybridized according to the principle of complementary base pairing
with anti-TAG probes on microspheres followed by the capture of Biotin products.
Then Strep Avidin-PE was added to complete a hybridization system, microspere-anti-TAG
probe-PCR-LDR product-Biotin-Strep Avidin-PE complex. Finally, Luminex 200 was
applied to detect correspondent florescent signal. When analyzed by Luminex
detecting software, mutation type was determined by microsphere code whereas
quantity of mutation was inspected by the florescent signal intensity. Thus,
this technology utilizes microspheres as the solid support for a DNA
hybridization assay, which is subsequently analyzed on a flow cytometer (see Figure
1).
In this study, we developed a multiplexed liquid-chip luminex
assay for EGFR and K-ras mutant detection. The results indicate that the assay
has potential as a diagnostic tool. To obtain a specific and efficiency
reaction condition, we optimized the primer and probe solutions, reaction ratio,
annealing temperature, different hybridization temperature and time. Then, the multiple
fluorophores were simultaneously detected by the luminex streaming a chine from
a single PCR
reaction tube, and the MFI reading were counted on the computer.
In this process, primers and probes for each target may interfere with one
another by forming dimers and/or by non-specific partial binding to target
sequences, which can be minimized by optimizing primers and probes via
appropriate use of sequence conservation and variability among the targets. Our
data demonstrated that luminex assay is simple to handle with money-and time saving.
Most importantly, it provides for the identification of up
to 8 mutant sites in a single reaction, suggesting that mutants can be detected
for dozens of patients at the same time. As direct sequencing of PCR-amplified
genomic DNA has been used as the gold standard to detect EGFR and K-ras
mutations [11], we compared luminex assay with sequencing and found a high
concordance rate (79.4% and 100%) for the detection of EGFR and K-ras gene
mutation between the two techniques. Further analysis demonstrated that the
luminex assay has its advantage over sequencing in the EGFR mutant detection,
especially in the EGFR mutant common sites – the15-bp deletion in exon 19 and
the L858R site substitution in exon 21. Our data further showed that The two mutant
rates are17.52% and 22.68% individual, compared with the sequencing 15% and 25%
(p>0.05). For the luminex assay, in the17 patients with the exon 19
deletion, 12 (70.6%) had 15-bp deletions (10 with delE746-A750-1 and 2 with del
E746-A750-2), compared to the sequencing 46.2% del E746-A750 in all exon 19
deletion; Again, in the 22 patients with exon 21mutation, 21 (95.5%) had the same
mutation site exon21 mutation L858 Ras sequencing 88.9% (see Table 7). Those
data demonstrate the luminex method mainly focused on the two sites mutant
detection and showed obviously advantages compared with DNA sequencing. As to
the there were 51% mutant rates of lung cancer patients in our hospital, which is
much higher than that in the foreign countries. In addition, the EGFR mutant
rates showed obvious difference (p<0.05) between male and female, smokers
and non-smokers as other study reported [12]. But the EGFR mutants were not
associated with different tissue types, such as the adenomatous
carcinoma and Squamous cell carcinoma. One of the reasons might be that the
tumor tissues contained some mixed types. Both methods revealed that the K-ras
mutant was 5%, which is similar to the published data from Asia countries [13].
Furthermore, the Luminex technology is flexible. It can be expanded to include more
mutant sites, detect the respiratory virus infection, type HPV, and screen for
a large panel of intestinal parasites as needed [14,15]. It can also be
modified in the future to accommodate more lineage-specific probes for subtyping
if necessary. Luminex was demonstrated a more accessible assay than DNA
sequencing to rapidly screen EGFR mutations in cancers, especially in the exon
19 and 21 sites. In addition, tumors from other types of cancers have shown
some responsiveness to EGFR inhibitors, and high frequency of EGFR mutations
(E746_A750del and L858R) has been reported in esophageal, pancreatic, and
ovarian cancers. Thus, the detection of EGFR and K-ras mutant status by
liquid-chip luminex assay will have a broad perspective for the clinical
applications in future.
Figure 1: Schematic
of detecting EGFR mutations by PCR-LDR reaction combined with liquid chip Note:
wild represents EGFR wild DNA PCR products, mutant represents EGFR mutant PCR
products. Red segments represent TAG sequence of upper ligating probes. P
represents 5’ phosphorylation label of lower probes. Green segments represent
3’Biotin label of lower probes. Hybridization represents
microspere-probe-ligating products-fluorescein complex.
|
Name |
Mutation |
Exon |
Base Change |
|
18M |
G719C |
18 |
2155G>T |
|
19M1 (1) |
E746-A750 del (1) |
19 |
2235_2249 del 15 |
|
19M1 (2) |
E746-A750 del (2) |
19 |
2235_2250 del 15 |
|
19M2 |
L747_T751>S |
19 |
2240_2251 del 12 |
|
19M3 |
L747_P753>S |
19 |
2240_2257 del 18 |
|
20M |
T790M |
20 |
2369C>T |
|
21M1 |
L858R |
21 |
2573T>G |
|
21M2 |
L861Q |
21 |
2582T>A |
Table 1: 8 EFGR gene mutations.
|
Classification |
Description |
Number |
Rates |
|
Age |
>=60 |
52 |
52% |
|
<60 |
48 |
48% |
|
|
Xs |
60±10 |
|
|
|
Sex |
male |
51 |
51% |
|
female |
49 |
49% |
|
|
Smoking |
Smoker |
30 |
33.30% |
|
history |
Nonsmoker |
60 |
66.70% |
|
Clinical stages |
I |
24 |
26.70% |
|
II |
22 |
24.40% |
|
|
III |
19 |
21.10% |
|
|
IV |
25 |
27.80% |
|
|
Histological |
Adenocarcinoma |
63 |
70% |
|
classification |
Squamous cell |
|
17.80% |
|
carcinoma |
16 |
|
|
|
Other lung cancer |
11 |
12.20% |
Table 2: Clinical parameter.
|
Primer ID |
Sequence(5’→3’) |
|
EGFR 18 forward primer |
CCATGCACAACTTCCCTACC |
|
EGFR 18 reverse primer |
ACAGCTTGCAAGGACTCTGG |
|
EGFR 19 forward primer |
CCCCAGCAATATCAGCCTTA |
|
EGFR 19 reverse primer |
AGTGCTGGGTAGATGCCAGT |
|
EGFR 20 forward primer |
CTCTCCCACTGCATCTGTCA |
|
EGFR 20 reverse primer |
CATATCCCCATGGCAAACTC |
|
EGFR 21 forward primer |
CCTCACAGCAGGGTCTTCTC |
|
EGFR 21 reverse primer |
ATCCTGCAGGGAGAGACTGA |
|
K-ras forward primer K- |
AGGCCTGCTGAAAATGACTGA |
|
ras reverse primer EGFR |
CCTCTATTGTTGGATCATATTCGT |
|
L18U ligation probe EGFR |
TAG1-CTGAATTCAAAAAGATCAAAGTGCTGT |
|
L18L ligation probe |
P+GCTCCGGTGCGTTCGGCACG+Biotin |
|
EGFR L191(1)U ligation probe |
TAG2-AAAGTTAAAATTCCCGTCGCTATCAA |
|
EGFR L191(1)L ligation probe |
P+AACATCTCCGAAAGCCAACAAGGA +Biotin |
|
EGFR L191(2)U ligation probe |
TAG3+AGTTAAAATTCCCGTCGCTATCAAG |
|
EGFR L191(2)L ligation probe |
P+ACATCTCCGAAAGCCAACAAGGAA +Biotin |
|
EGFR L192U ligation probe |
TAG4+AAAATTCCCGTCGCTATCAAGGAAT |
|
EGFR L192L ligation probe |
P+CATCTCCGAAAGCCAACAAGGAAA +Biotin |
|
EGFR L193U ligation probe |
TAG5+AAAATTCCCGTCGCTATCAAGGAAT |
|
EGFR L193L ligation probe |
P+CGAAAGCCAACAAGGAAATCCTCG +Biotin |
|
EGFR L790U ligation probe |
TAG6+GCAGCTCATGCCCTTCGGCTG |
|
EGFR L790L ligation probe |
P+ACCTCCACCGTGCAGCTCATCAT+Biotin |
|
EGFR L211U ligation probe |
TAG7+TGTCAAGATCACAGATTTTGGGCG |
|
EGFR L211L ligation probe |
P+GGCCAAACTGCTGGGTGCGGA+Biotin |
|
EGFR L212U ligation probe |
TAG8+CACAGATTTTGGGCTGGCCAAACA |
|
EGFR L212L ligation probe |
P+GCTGGGTGCGGAAGAGAAAGAAT+Biotin |
|
K1M (Gly12Asp) ligation probe |
TAG1-ATAAACTTGTGGTAGTTGGAGCTGA |
|
|
P+ TGGCGTAGGCAAGAGTGCCTTG +Biotin |
|
K2M (Gly12Val) ligation probe |
TAG2-ATAAACTTGTGGTAGTTGGAGCTGT |
|
|
P+ TGGCGTAGGCAAGAGTGCCTTG +Biotin |
|
K3M (Gly12Ser) ligation probe |
TAG3+ATATAAACTTGTGGTAGTTGGAGCTA |
|
|
P+ GTGGCGTAGGCAAGAGTGCCTT +Biotin |
|
K4M (Gly12Cys) ligation probe |
TAG4+ATATAAACTTGTGGTAGTTGGAGCTT |
|
|
P+ GTGGCGTAGGCAAGAGTGCCTT +Biotin |
|
K5M (Gly12Ala) ligation probe |
TAG5+TAAACTTGTGGTAGTTGGAGCTGC |
|
|
P+ TGGCGTAGGCAAGAGTGCCTTG +Biotin |
|
K6M (Gly12Arg) ligation probe |
TAG6+ATATAAACTTGTGGTAGTTGGAGCTC |
|
|
P+ GTGGCGTAGGCAAGAGTGCCTT +Biotin |
|
K7M (Gly13Asp) ligation probe |
TAG7+CTTGTGGTAGTTGGAGCTGGTGA P+ |
|
|
CGTAGGCAAGAGTGCCTTGACG +Biotin |
|
K8M (Gly13Cys) ligation probe |
TAG8+ACTTGTGGTAGTTGGAGCTGGTTG |
|
|
P+ CGTAGGCAAGAGTGCCTTGACG +Biotin |
Table 3: Sequence of primers.
|
|
Methods |
|
|
Lumine |
|
Sequenci |
|
|
Lumine |
|
Sequencin |
|
P value |
|
|
|
|
|
|
x |
|
ng (100) |
|
|
x |
|
g |
|
|
|
|
|
|
|
(97) |
|
|
(97) |
(100) |
|
|
|||||
|
|
Mutant Sites |
|
|
Number |
|
|
|
Rates % |
|
|
||||
|
|
|
|
|
|
|
|
|
|
|
|
|
|
||
|
|
Total mutant |
|
39 |
51 |
40.2 |
51 |
0.15 |
|||||||
|
|
number |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
21:L858R |
|
21 |
24 |
21.65 |
24.00 |
0.73 |
|||||||
|
|
19: E746-A750del |
12 |
13 |
12.37 |
13.00 |
1 |
||||||||
|
|
19: |
|
3 |
1 |
2.06 |
1.00 |
0.36 |
|||||||
|
|
delL747-P753insS |
|
|
|
|
|
|
|
|
|
|
|
||
|
|
19: delL747-T751 |
2 |
1 |
3.09 |
1.00 |
0.61 |
||||||||
|
|
21: L861Q |
|
|
1 |
|
1 |
|
1.03 |
|
1.00 |
|
1 |
||
Table 4: The comparison of Luminex and sequencing in the EGFR mutation detection.
|
|
|
21:L858R |
19: delE746-A750 |
||||||
|
|
|
Luminex |
Sequencing |
Luminex |
Sequencing |
||||
|
|
|
21(53.85%) |
24(47.06%) |
12(30.77%) |
13(25.49%) |
||||
|
Age |
>=60 |
13 |
25 |
16 |
30.77 |
5 |
9.62 |
4 |
7.69 |
|
<60 |
8 |
16.67 |
8 |
16.7 |
7 |
14.58 |
9 |
18.75 |
|
|
P value |
0..76 |
|
|
|
0.69 |
|
|
|
|
|
Sex |
male |
4 |
7.84 |
7 |
13.73 |
5 |
9.8 |
4 |
7.84 |
|
female |
17 |
34.69 |
17 |
34.69 |
7 |
14.29 |
9 |
18.37 |
|
|
P value |
0.5 |
|
|
|
0.69 |
|
|
|
|
|
Smoking |
Yes |
2 |
6.67 |
4 |
13.33 |
3 |
10 |
3 |
10 |
|
No |
16 |
26.67 |
16 |
26.67 |
8 |
13.33 |
9 |
15 |
|
|
P value |
0.66 |
|
|
|
1 |
|
|
|
|
|
Histological classification |
AD |
15 |
23.81 |
15 |
23.81 |
0 |
0 |
0 |
0 |
|
SCC |
2 |
12.5 |
3 |
18.75 |
11 |
68.75 |
12 |
75 |
|
|
OLC |
2 |
18.18 |
2 |
18.18 |
0 |
0 |
0 |
0 |
|
|
P value |
0.91 |
|
|
|
|
|
|
|
|
|
Clinical stages |
I |
5 |
20.83 |
4 |
16.67 |
4 |
16.66 |
4 |
16.66 |
|
II |
4 |
18.18 |
4 |
18.18 |
2 |
9.09 |
3 |
13.64 |
|
|
III |
3 |
16.67 |
3 |
16.67 |
1 |
5.26 |
0 |
0 |
|
|
IV |
6 |
24 |
9 |
36 |
4 |
16 |
5 |
20 |
|
|
P value |
0.89 |
|
|
|
|
|
|
|
|
AD: adenocarcinoma ; SCC: Squamous cell carcinoma ; OLC: Other lung cancer;
Table 5: Exon 19 and 21 mutation status comparison of the two methods.
|
|
|
K-ras mutation |
P value |
Gly12Val (GGT>GTT) |
Gly12Asp (GGT>GAT) |
|||
|
|
No. |
Rates % |
No. |
Rates % |
No. |
Rates % |
||
|
Age |
>=60 |
3 |
5.77 |
1 |
3 |
5.77 |
|
|
|
<60 |
2 |
6.25 |
|
|
|
2 |
6.25 |
|
|
Sex |
male |
4 |
7.84 |
0.36 |
2 |
3.92 |
2 |
3.92 |
|
female |
1 |
8.16 |
|
1 |
8.16 |
|
|
|
|
Smoking |
Yes |
3 |
10 |
0.33 |
1 |
1.7 |
2 |
3.3 |
|
No |
2 |
3.3 |
|
2 |
3.3 |
|
|
|
|
Histological classification |
AD |
4 |
6.35 |
1 |
3 |
4.76 |
1 |
1.59 |
|
SCC |
1 |
6.25 |
|
|
|
1 |
6.25 |
|
|
Clinical stages |
IIIb |
1 |
5.56 |
0.38 |
1 |
5.56 |
|
|
|
IV |
4 |
16 |
|
2 |
8 |
2 |
8 |
|
|
EGFR mutant |
Yes |
0 |
|
|
0 |
|
0 |
|
|
No |
5 |
|
|
3 |
|
2 |
|
|
AD: adenocarcinoma; SCC: Squamous cell carcinoma ; No. Number;
Table 6: Distribution of K-ras mutation status
|
|
luminex |
Sequencing |
|
Person requirement |
Short-time train |
Long-time train |
|
DNA solution requirement |
20 ng |
50 µg |
|
Detection sample number |
96 |
One by one |
|
Operation |
Easy |
Complex |
|
Time-cost |
<2 hours for 96 samples |
>2 hours for 1 samples |
|
Money-cost |
1000 |
5000 |
|
Sensitivity |
ordinary |
common |
|
Specialist |
Very well, especially in the two hot mutant sites |
Not be special in some mutant sites; |
|
Result |
Digital signal; Relative quantity |
Fluorescence signal; Quality; |
|
Send report time |
That very day for all the samples |
Next day for one samples; |
Table 7. Total index comparison for the two methods
- Yu J, Kane S, Wu J, Benedettini E, Li D, et al. (2009)
Mutation-specific antibodies for the detection of EGFR mutations in
non-small-cell lung cancer. Clin Cancer Res 15: 3023-3028.
- Wu SG, Chang YL, Lin JW, Wu CT, Chen H, et al. (2011)
Including total EGFR staining in scoring improves EGFR mutations detection by
mutation-specific antibodies and EGFR TKIs response prediction. PLoS One 6:
23303.
- Watanabe S, Tanaka J, Ota T, Kondo R, Tanaka H, et al.
(2011) Clinical responses to EGFR-tyrosine kinase inhibitor retreatment
in non-small cell lung cancer patients who benefited from prior effective
gefitinib therapy: aretrospective analysis. BMC Cancer 11: 1.
- Do H, Krypuy M, Mitchell PL, Fox SB, Dobrovic A (2008)
High resolution melting analysis for rapid and sensitive EGFR and KRAS mutation
detection in formalin fixed paraffin embedded biopsies. BMC Cancer 8: 142.
- van Eijk R, Licht J, Schrumpf M, Talebian Yazdi M, Ruano
D, et al. (2011) Rapid KRAS, EGFR, BRAF and PIK3CA mutation analysis of fine
needle aspirates from non-small-cell lung cancer using allele-specific qPCR.
PLoS One 6: 17791.
- Malapelle U, de Rosa N, Rocco D, Bellevicine C, Crispino
C, et al. (2011) EGFR and KRAS mutations detection on lung cancer
liquid-based cytology: a pilot study. J Clin Pathol 65: 87-91.
- Sun L, Zhang Q, Luan H, Zhan Z, Wang C, et al. (2011)
Comparison of KRAS and EGFR gene status between primary non-small cell lung
cancer and local lymph node metastases: implications for clinical practice. J
Exp Clin Cancer Res 30: 30.
- Zhang H, Zheng X, Ji T, Fu L, Bai D,et al. (2011)
Comparative Screening of K-ras Mutations in Colorectal Cancer and Lung Cancer
Patients Using a Novel Real-Time PCR with ADx-K-ras Kit and Sanger
DNA Sequencing. Cell Biochem Biophys 62: 415-420.
- Santis G, Angell R, Nickless G, Quinn A, Herbert A, et
al. (2011) Screening for EGFR and KRAS mutations in endobronchial
ultra sound derived transbronchial needle aspirates in non-small cell lung cancer
using COLD-PCR. PLoS One 6: 25191.
- Simonetti S, Molina MA, Queralt C, de Aguirre I, Mayo C,
et al. (2010) Detection of EGFR mutations with mutation-specific antibodies in
stage IV non-small-cell lung cancer. J Transl Med 8: 135.
- Liu Y, Liu B, Li XY, Li JJ, Qin HF, Tang CH, et al.
(2011) A comparison of ARMS and direct sequencing for EGFR mutation analysis and
Tyrosine Kinase Inhibitors treatment prediction in body fluid samples of
Non-Small-Cell Lung Cancer patients. J Exp Clin Cancer Res 30: 111.
- Ren JH, He WS, Yan GL, Jin M, Yang KY, et al. (2012) EGFR
mutations in non-small-cell lung cancer among smokers and non-smokers: a
meta-analysis. Environ Mol Mutagen 53: 78-82.
- Zhong W, Chen M, Xian L, Li M (2011) [Study on point
mutations of K-ras gene in non-small cell lung cancer in Guangxi]. Zhongguo Fei
Ai ZaZhi 14: 507-511.
- Taniuchi M,Jaco J. Verweij, Zannatun Noor, Shihab U.
Sobuz, Lisette van Lieshout, et al. (2011) High throughput multiplex PCR and
probe-based detection with Luminex beads for seven intestinal parasites. Am J
Trop Med Hyg 84: 332-337.
- Pabbaraju K,Sallene Wong, Kara L. Tokaryk, Kevin Fonseca,
Steven J. Drews, et al. (2011) Comparison of the Luminexx TAG respiratory viral
panel with xTAG respiratory viral panel fast for diagnosis of respiratory virus
infections. J Clin Microbiol 49: 1738-1744.
© by the Authors & Gavin Publishers. This is an Open Access Journal Article Published Under Attribution-Share Alike CC BY-SA: Creative Commons Attribution-Share Alike 4.0 International License. Read More About Open Access Policy.